Annealing is useful for a subset of optimization computing problems.
|
|
And that is because of the choice of quantum annealing.
|
|
This doesn't necessarily mean doom for quantum annealing or D-Wave.
|
|
In this case, the conductivity comes about through annealing, or heating and slowly cooling the material.
|
|
These forms of quantum computing are arguably more pure, but that doesn't mean annealing is useless.
|
|
What I concluded is that the D-wave quantum annealing technology is powerful and has intelligence applications.
|
|
The Burnaby, British Columbia based company's chips fall under a specific class of quantum computing called quantum annealing.
|
|
Unlike other players in the quantum computing market, D-Wave always bet on quantum annealing as its core technology.
|
|
Annealing allows you to set up the problem, and then let the system fall into the answer—in about 0003 milliseconds.
|
|
Most of the cute mathematics goes into choosing an effective annealing schedule—the rule for how the size of kicks decreases.
|
|
The Yemen war has wreaked horrors on that country, but it appears to have had an annealing effect on Emirati society.
|
|
The D-Wave 2000Q performs calculations through a controversial process known as "quantum annealing," which renders a problem as a topographical map.
|
|
D-Wave is now working on a prototype of a universal annealing quantum computer, says Alan Baratz, the company's chief product officer.
|
|
Williams says he's certain that quantum annealing is the best way to make a quantum computer, and that other approaches are too theoretical.
|
|
The melting pot of New York, curiously, produced the most distinct and separate crucibles, each annealing the complexities of identity into political causes.
|
|
D-Wave remains the only major player that's betting on annealing, but the company's CEO Vern Brownell remains optimistic that this is the right approach.
|
|
A paper out this week in the Physical Review Letters suggests that quantum annealing is probably not faster than classical computing given real-world temperature constraints.
|
|
What throws a kink into the quantum timeline is D-Wave's 2000Q system, which is a kind of quantum computer that's based on what's known as quantum annealing.
|
|
"[Quantum annealing] has tremendous advantages over other schemes." no real proof of a quantum speedup But researchers say the benefits of D-Wave's method have never been proved.
|
|
Grossly simplified, with quantum annealing, you are building a system that almost naturally optimizes itself for the lowest energy state, which then represents the solution to your problem.
|
|
Read More: IBM Just Made a 17 Qubit Quantum Processor, Its Most Powerful One Yet Quantum annealing is a computing paradigm that exploits the natural inclinations of a quantum system.
|
|
This method is called simulated annealing, because of a metaphorical resemblance to the way atoms in liquid metal behave as the metal cools down, and finally freezes to a solid.
|
|
Apart from D-Wave's quantum annealing, there are three other main approaches to try and bend the quantum world to our whim: integrated circuits, topological qubits and ions trapped with lasers.
|
|
Microsoft is working on a different kind of "topological" qubit based on the behaviors of many electrons, and longtime quantum computing business D-Wave uses a specialized system called quantum annealing to perform optimization problems.
|
|
D-Wave focuses on a technology called quantum annealing, based on the natural tendency of real-world quantum systems to find low-energy states (a bit like a spinning top that inevitably will fall over).
|
|
"We feel more strongly about our decision to do quantum annealing now that there are a few companies that actually have quantum computers that people can access," he said in an interview earlier this month.
|
|
Quantum physics already offers us a possible way into solving these problems quicker through a process called quantum annealing, which uses particles, which naturally tend toward lowest-possible energy states, to emulate and solve mathematical problems.
|
|
Scott Aaronson of the University of Texas and Greg Kuperberg of UC Davis tell The Verge that while there was theoretical hope that quantum annealing would produce results, the tests have not borne this theory out.
|
|
So when he came second in the contest that year, he stayed on to try again, "annealing myself in the flame of my strong will", and working as a guard for British Rail to get by.
|
|
With its focus on quantum annealing, the company is able to build machines with thousands of qubits without having to worry about noise issues, though this also somewhat restricts what kind of problems users can solve with these machines.
|
|
I got very interested in whether the D-wave quantum annealing technology had borne real fruit that would be useful in an intelligence sense, so I traveled out to Vancouver and I met with Geordie Rose who is kind of the intellectual founder.
|
|
IBM TrueNorth unit IBM TrueNorth unit Similar to other experimental computing hardware like chips enabling quantum annealing, IBM's TrueNorth approach has drawn criticism from some leaders of the field who say it offers limited advantages over more conventional custom chips, FPGAs and GPUs.
|
|
The book ends up I think being accurate in saying that although D-wave quantum technology is not quantum computing—that the annealing effects that it does generate have certain applications as in pattern recognition, other things that are like the optimization that it does so well—that it's still worth taking seriously.
|
|
A 39, R393 (2006) evidence suggests that quantum annealing outperforms simulated annealing under certain conditions (see for a careful analysis).
|
|
Annealing by short circuit is a method of efficiently annealing copper wire which employs a controlled electrical short circuit. It can be advantageous because it does not require a temperature-regulated furnace like other methods of annealing.
|
|
Quantum annealing can be compared to simulated annealing, whose "temperature" parameter plays a similar role to QA's tunneling field strength. In simulated annealing, the temperature determines the probability of moving to a state of higher "energy" from a single current state. In quantum annealing, the strength of transverse field determines the quantum-mechanical probability to change the amplitudes of all states in parallel. Analytical and numerical G. E. Santoro and E. Tosatti, "Optimization using quantum mechanics: quantum annealing through adiabatic evolution" J. Phys.
|
|
Process annealing, also called intermediate annealing, subcritical annealing, or in-process annealing, is a heat treatment cycle that restores some of the ductility to a product being cold-worked so it can be cold-worked further without breaking. The temperature range for process annealing ranges from 260 °C (500 °F) to 760 °C (1400 °F), depending on the alloy in question. This process is mainly suited for low-carbon steel. The material is heated up to a temperature just below the lower critical temperature of steel.
|
|
Annealing is a process of slowly cooling hot glass objects after they have been formed, to relieve residual internal stresses introduced during manufacture. Especially for smaller, simpler objects, annealing may be incidental to the process of manufacture, but in larger or more complex products it commonly demands a special process of annealing in a temperature- controlled kiln known as a lehr.E. F. Collins (1921) Electrically heated glass annealing lehr. Journal of the American Ceramic Society 4 (5), pp. 335–349 Annealing of glass is critical to its durability.
|
|
The high temperature of annealing may result in oxidation of the metal's surface, resulting in scale. If scale must be avoided, annealing is carried out in a special atmosphere, such as with endothermic gas (a mixture of carbon monoxide, hydrogen gas, and nitrogen gas). Annealing is also done in forming gas, a mixture of hydrogen and nitrogen. The magnetic properties of mu-metal (Espey cores) are introduced by annealing the alloy in a hydrogen atmosphere.
|
|
Shor's algorithm requires a universal quantum computer. D-Wave claims only to do quantum annealing. "A cross-disciplinary introduction to quantum annealing-based algorithms" presents an introduction to combinatorial optimization (NP-hard) problems, the general structure of quantum annealing-based algorithms and two examples of this kind of algorithms for solving instances of the max-SAT and Minimum Multicut problems, together with an overview of the quantum annealing systems manufactured by D-Wave Systems.
|
|
In consequence the bonding strength rises with increasing annealing temperatures.
|
|
Techniques such as annealing induced diffusion and ion-implantation are used.
|
|
The problem was resolved by annealing the cases, and storing the cartridges elsewhere.
|
|
Annealing at 350 °C results in bonding strengths similar to high- temperature bonding.
|
|
The hydrogen concentration and bonding configuration were controlled by post-deposition isochronal annealing.
|
|
A new approach to break carbonaceous catalyst encapsulations is based on rapid thermal annealing.
|
|
This approach has been implemented in the program MSASA (Multiple Sequence Alignment by Simulated Annealing).
|
|
Similar to bonding of hydrophilic surfaces, the pre-bond is followed by an annealing process.
|
|
Annealing is the process of heating the iron-hydrogen alloy to a sufficiently high temperature to relieve local internal stresses. It does not create a general softening of the product but only locally relieves strains and stresses locked up within the material. Annealing goes through three phases: recovery, recrystallisation, and grain growth. The temperature required to anneal a particular iron hydride depends on the type of annealing to be achieved and the alloying constituents.
|
|
Following annealing, any overhanging bases (flaps) are removed by nucleases such as Fen1 and gaps are filled in by DNA polymerase theta. This gap-filling ability of polymerase theta helps to stabilize the annealing of ends with minimal complementarity. Besides microhomology footprints, polymerase theta's mutational signature also consists of (infrequent) templated inserts, which are thought to be the result of aborted template-dependent extension, followed by re-annealing at secondary homologous sequences.
|
|
However, as many functions are not convex hill climbing may often fail to reach a global maximum. Other local search algorithms try to overcome this problem such as stochastic hill climbing, random walks and simulated annealing. Despite the many local maxima in this graph, the global maximum can still be found using simulated annealing. Unfortunately, the applicability of simulated annealing is problem-specific because it relies on finding lucky jumps that improve the position.
|
|
This involved annealing its reactor pressure vessel and using parts from the recently shutdown unit 3.
|
|
Their properties strongly depend on the measurement and annealing temperature. They can also exhibit inverse GMR.
|
|
Isochronal annealing of the SiC between 300 and 1200 K also showed no significant helium loss.
|
|
Pairs of primers should have similar melting temperatures since annealing during PCR occurs for both strands simultaneously, and this shared melting temperature must not be either too much higher or lower than the reaction's annealing temperature. A primer with a Tm (melting temperature) too much higher than the reaction's annealing temperature may mishybridize and extend at an incorrect location along the DNA sequence. A Tm significantly lower than the annealing temperature may fail to anneal and extend at all. Additionally, primer sequences need to be chosen to uniquely select for a region of DNA, avoiding the possibility of hybridization to a similar sequence nearby.
|
|
In order to find global optimum, global optimization algorithms such as simulated annealing are required. Unfortunately, simulated annealing may be hard to parallelize on modern multicore computers. Given enough time, simulated annealing can be shown to find the global optimum with a probability approaching 1, but such convergence proof does not mean the required time is reasonably low. In 1998, it was found that genetic algorithms are robust and fast fitting methods for X-ray reflectivity.
|
|
Above this threshold crystals tend to remain clear at reasonable growth rates and maintains good annealing conditions.
|
|
The problem was solved by annealing the brass cases after forming so as to relieve the residual stresses.
|
|
The copolymer generally exhibited a single melting endotherm for its unannealed state, but displayed multiple endotherms after annealing.
|
|
As glass cools, it shrinks and solidifies. Uneven cooling causes weak glass due to stress. Even cooling is achieved by annealing. An annealing oven (known in the industry as a lehr) heats the container to about , then cools it, depending on the glass thickness, over a 20 – 60 minute period.
|
|
Simulated annealing decreases this temperature over time, thus allowing more random moves at the beginning and less after time.
|
|
However, all annealing based assembly methods require the primers to be mixed together in one tube. In this case, shorter overlaps do not always allow precise and specific annealing of complementary primers, resulting in the inhibition of full length product formation. Manual design of oligonucleotides is a laborious procedure and does not guarantee the successful synthesis of the desired gene. For optimal performance of almost all annealing based methods, the melting temperatures of the overlapping regions are supposed to be similar for all oligonucleotides.
|
|
Presence of a significant amount of uranium allowed scientists to estimate the age of tranquillityite and some associated minerals in Apollo 11 samples as 3710 million years using the uranium-lead dating technique. Irradiation by alpha particles generated by uranium decay is believed to be the origin of the predominantly amorphous metamict structure of tranquillityite. Its crystals were obtained by annealing the samples at for 30 minutes. Longer annealing did not improve the crystalline quality, and annealing at higher temperatures resulted in spontaneous fracture of samples.
|
|
Depressurization allows considerable expansions of a mine, and can extend the life of the mine by 10 to 15 years. One technique used in depressurization is annealing. Annealing is the slow heating and cooling of a metal, alloy or glass. This slow heating and cooling relieves the internal stress of surrounding areas.
|
|
Annealing increases order in the polymer phase, increasing conductivity. However, annealing for too long causes the polymer domain size to increase, eventually making it larger than the exciton diffusion length, and possibly allowing some of the metal from the contact to diffuse into the photoactive layer, reducing the efficiency of the device.
|
|
Manufacturing bullet jackets is similar to making brass cases: there is a series of drawing steps with annealing and washing.
|
|
An experimental demonstration of the success of quantum annealing for random magnets was reported immediately after the initial theoretical proposal.
|
|
Other high- permeability nickel–iron alloys such as permalloy have similar magnetic properties; mu-metal's advantage is that it is more ductile, malleable and workable, allowing it to be easily formed into the thin sheets needed for magnetic shields. Mu-metal objects require heat treatment after they are in final form—annealing in a magnetic field in hydrogen atmosphere, which increases the magnetic permeability about 40 times. The annealing alters the material's crystal structure, aligning the grains and removing some impurities, especially carbon, which obstruct the free motion of the magnetic domain boundaries. Bending or mechanical shock after annealing may disrupt the material's grain alignment, leading to a drop in the permeability of the affected areas, which can be restored by repeating the hydrogen annealing step.
|
|
Next, the glass–cutter cut the cylinder, and the glass was flattened. It was necessary to gradually cool the glass, a process known as annealing, to prevent it from breaking. A lehr or annealing oven was used to anneal the product. A typical 20th-century lehr was a large conveyor inside a long oven.
|
|
It can also be synthesized by annealing an Fe-Ni-C alloy at ambient pressure for several hundred hours. The annealing is carried out in two stages: first a mixture of cohenite and kamacite is formed in air at ca. 950 °C; it is then partly converted to cliftonite in vacuum at ca. 550 °C.
|
|
The Simulated annealing algorithm is designed by looking at how the pure crystals form from a heated gaseous state while the system is cooled slowly.Arts and Krost, 1997 The computing problem is redesigned as a simulated annealing exercise and the solutions are arrived at. The working principle of simulated annealing is borrowed from metallurgy: a piece of metal is heated (the atoms are given thermal agitation), and then the metal is left to cool slowly. The slow and regular cooling of the metal allows the atoms to slide progressively their most stable ("minimal energy") positions.
|
|
Simulated annealing is closely related to graduated optimization. Instead of smoothing the function over which it is optimizing, simulated annealing randomly perturbs the current solution by a decaying amount, which may have a similar effect. Because simulated annealing relies on random sampling to find improvements, however, its computation complexity is exponential in the number of dimensions being optimized. By contrast, graduated optimization smooths the function being optimized, so local optimization techniques that are efficient in high-dimensional space (such as gradient-based techniques, hill climbers, etc.) may still be used.
|
|
Powder can be reduced by some kind of pre-consolidation treatment, such as annealing used for the manufacture of ceramic tools.
|
|
Common approaches to global optimization problems, where multiple local extrema may be present include evolutionary algorithms, Bayesian optimization and simulated annealing.
|
|
For any given finite problem, the probability that the simulated annealing algorithm terminates with a global optimal solution approaches 1 as the annealing schedule is extended. This theoretical result, however, is not particularly helpful, since the time required to ensure a significant probability of success will usually exceed the time required for a complete search of the solution space.
|
|
Sometimes it is better to move back to a solution that was significantly better rather than always moving from the current state. This process is called restarting of simulated annealing. To do this we set `s` and `e` to `sbest` and `ebest` and perhaps restart the annealing schedule. The decision to restart could be based on several criteria.
|
|
Fission tracks are preserved in a crystal when the ambient temperature of the rock falls below the annealing temperature. This annealing temperature varies from mineral to mineral and is the basis for determining low-temperature vs. time histories. While the details of closure temperatures are complicated, they are approximately 70 to 110 °C for typical apatite, c.
|
|
Only spheroidized steel is softer and more ductile.Smith, p. 386 ; Process annealing: A process used to relieve stress in a cold-worked carbon steel with less than 0.3% C. The steel is usually heated to 550–650 °C for 1 hour, but sometimes temperatures as high as 700 °C. The image rightward shows the area where process annealing occurs.
|
|
The Glass Blowing Shop repairs glassware and fabricates customised glassware. It is equipped with burners, lathe, grinding machine, annealing furnace, and tools.
|
|
An additional advantage provided by annealing is the healing of crystallographic defects produced by fabrication, and the process also smoothens the tip surface.
|
|
Low hydrogen annealing is a heat treatment in metallurgy for the reduction or elimination of hydrogen in a material to prevent hydrogen embrittlement.
|
|
Quantum annealing (QA) is a metaheuristic for finding the global minimum of a given objective function over a given set of candidate solutions (candidate states), by a process using quantum fluctuations (in other words, a meta- procedure for finding a procedure that finds an absolute minimum size/length/cost/distance from within a possibly very large, but nonetheless finite set of possible solutions using quantum fluctuation-based computation instead of classical computation). Quantum annealing is used mainly for problems where the search space is discrete (combinatorial optimization problems) with many local minima; such as finding the ground state of a spin glass or the traveling salesman problem. It was formulated in its present form by T. Kadowaki and H. Nishimori (ja) in "Quantum annealing in the transverse Ising model" though a proposal in a different form had been made by A. B. Finnila, M. A. Gomez, C. Sebenik and J. D. Doll, in "Quantum annealing: A new method for minimizing multidimensional functions". Quantum annealing starts from a quantum-mechanical superposition of all possible states (candidate states) with equal weights.
|
|
Another approach to prevent or reduce PD formation is by modifying the primers so that annealing with themselves or each other does not cause extension. HANDS (Homo-Tag Assisted Non-Dimer System): a nucleotide tail, complementary to the 3' end of the primer is added to the 5' end of the primer. Because of the close proximity of the 5' tail it anneals to the 3' end of the primer. The result is a stem-loop primer that excludes annealing involving shorter overlaps, but permits annealing of the primer to its fully complementary sequence in the target.
|
|
This notion of slow cooling implemented in the simulated annealing algorithm is interpreted as a slow decrease in the probability of accepting worse solutions as the solution space is explored. Accepting worse solutions allows for a more extensive search for the global optimal solution. In general, simulated annealing algorithms work as follows. The temperature progressively decreases from an initial positive value to zero.
|
|
Therefore, the ideal cooling rate cannot be determined beforehand, and should be empirically adjusted for each problem. Adaptive simulated annealing algorithms address this problem by connecting the cooling schedule to the search progress. Other adaptive approach as Thermodynamic Simulated Annealing, automatically adjusts the temperature at each step based on the energy difference between the two states, according to the laws of thermodynamics.
|
|
This discontinuous synthesis results in the lagging strand being more exposed which allows for easier beta-mediated annealing of the oligo to the target DNA than when compared to annealing to the leading strand. Finally, the mismatch repair (MMR) machinery offers inherent protection to the cell against nucleotide base mismatch. Therefore, any mutations introduced in the oligonucleotides can be targeted by the MMR.
|
|
A hybridization assay comprises any form of quantifiable hybridization i.e. the quantitative annealing of two complementary strands of nucleic acids, known as nucleic acid hybridization.
|
|
Simulated Annealing can be used to solve combinatorial problems. Here it is applied to the travelling salesman problem to minimize the length of a route that connects all 125 points. Simulated annealing (SA) is a probabilistic technique for approximating the global optimum of a given function. Specifically, it is a metaheuristic to approximate global optimization in a large search space for an optimization problem.
|
|
Metals can be heat treated to alter the properties of strength, ductility, toughness, hardness or resistance to corrosion. Common heat treatment processes include annealing, precipitation hardening, quenching, and tempering. The annealing process softens the metal by allowing recovery of cold work and grain growth. Quenching can be used to harden alloy steels, or in precipitation hardenable alloys, to trap dissolved solute atoms in solution.
|
|
Solvent vapour annealing (SVA) is a widely used technique for controlling the morphology and ordering of block copolymer (BCP) films. By controlling the block ratio (f = NA/N), spheres, cylinders, gyroids and lamellae structures can be readily generated by swelling of the BCP thin film using solvent vapor to facilitate the self-assembly of the polymer blocks. It is a more mild alternative to thermal annealing.
|
|
This was known as 'black pickling' and 'black annealing'. After being removed they were allowed to cool for up to 48 hours. The plates were then rolled cold through highly polished rolls to remove any unevenness and give them a polished surface. They were then annealed again (but at a lower temperature) and pickled again, this being known as 'white annealing' and 'white pickling'.
|
|
The amount of process-initiating Gibbs free energy in a deformed metal is also reduced by the annealing process. In practice and industry, this reduction of Gibbs free energy is termed stress relief. The relief of internal stresses is a thermodynamically spontaneous process; however, at room temperatures, it is a very slow process. The high temperatures at which annealing occurs serve to accelerate this process.
|
|
Typically, large ovens are used for the annealing process. The inside of the oven is large enough to place the workpiece in a position to receive maximum exposure to the circulating heated air. For high volume process annealing, gas fired conveyor furnaces are often used. For large workpieces or high quantity parts, car-bottom furnaces are used so workers can easily move the parts in and out.
|
|
Hexamer primers are sequences composed of six random nucleotides. For MDA applications, these primers are usually thiophosphate-modified at their 3’ end to convey resistance to the 3’-5’ exonuclease activity of Ф29 DNA polymerase. MDA reactions start with the annealing of such primers to the DNA template followed by polymerase-mediated chain elongation. Increasing numbers of primer annealing events happen along the amplification reaction.
|
|
These flat rolls or sheets of metal are then punched out into round blanks that are a little larger than the coin being struck. The blanks are then subjected to an annealing process that softens the metal through heating to approximately 750 degrees Celsius (1400 degrees Fahrenheit) and are then slowly air cooled. They are then washed to remove residue from the annealing process and dried.
|
|
Solutions to the problem use a variety of techniques, including both mathematically exact solutions and a variety of heuristic solutions using decomposition, parallel computing, stochastic optimization, genetic algorithms, colony optimization, simulated annealing, quantum annealing Tabu search, and coordinate descent. Burke et al. (2004) summarised the state of art of academic research to the nurse rostering problem, including brief introductions of various then published solutions.
|
|
This in vitro method is based on template switching to generate chimeric genes. This PCR based method begins with an initial denaturation of the template, followed by annealing of primers and a short extension time. All subsequent cycle generate annealing between the short fragments generated in previous cycles and different parts of the template. These short fragments and the templates anneal together based on sequence complementarity.
|
|
It has three main steps: denaturation, annealing, and extension. Denaturation splits the DNA into two single strands at high temperatures. Annealing involves attaching primer strands of DNA to the single strands that allow Taq polymerase to attach to the DNA. Extension occurs when Taq polymerase is added to the sample and matches base pairs to turn the two single strands into two complete double strands.
|
|
The physical analogy that is used to justify simulated annealing assumes that the cooling rate is low enough for the probability distribution of the current state to be near thermodynamic equilibrium at all times. Unfortunately, the relaxation time—the time one must wait for the equilibrium to be restored after a change in temperature—strongly depends on the "topography" of the energy function and on the current temperature. In the simulated annealing algorithm, the relaxation time also depends on the candidate generator, in a very complicated way. Note that all these parameters are usually provided as black box functions to the simulated annealing algorithm.
|
|
During the PCR procedure, DNA polymerase will extend any piece of DNA with bound primers, generating target products but also nonspecific products which lower the yield. In hot start PCR, some of the reagents are kept separate until the mixture is heated to the specific annealing temperature. This reduces annealing time, which in turn reduces the likelihood of non-specific DNA extension and the influence of non- specific primer binding prior to denaturation. In conventional PCR, lower temperatures below the optimal annealing temperature (50-65 °C) results in off target modifications such as non-specific amplifications where primers will bind non-specifically to the nucleic acid.
|
|
On May 11, 2011, D-Wave Systems announced D-Wave One, described as "the world's first commercially available quantum computer", operating on a 128-qubit chipset using quantum annealing (a general method for finding the global minimum of a function by a process using quantum fluctuations) to solve optimization problems. The D-Wave One was built on early prototypes such as D-Wave's Orion Quantum Computer. The prototype was a 16-qubit quantum annealing processor, demonstrated on February 13, 2007, at the Computer History Museum in Mountain View, California. D-Wave demonstrated what they claimed to be a 28-qubit quantum annealing processor on November 12, 2007.
|
|
Adiabatic quantum computation (AQC) is a form of quantum computing which relies on the adiabatic theorem to do calculations and is closely related to quantum annealing.
|
|
Short cycle annealing is used for turning normal ferrite into malleable ferrite. It consists of heating, cooling and then heating again from 4 to 8 hours.
|
|
Those coatings find applications in dynamic seals. The friction properties can be further tailored with high-temperature hydrogen annealing and subsequent hydrogen termination of dangling bonds.
|
|
Annealing of vacancies changes diamond color from green to yellow-brown. Similar mechanism (vacancy aggregation) is also believed to cause brown color of plastically deformed natural diamonds.
|
|
Depending on the desired characteristics of the finished product, annealing may be used before, during (between passes) or after the cold drawing operation, depending on material requirements.
|
|
Divergence from the reference sequences (from genetic mutations) results in poor annealing of the primers so that the marker cannot be used, representative of a null allele.
|
|
The mechanisms behind mitotic recombination are similar to those behind meiotic recombination. These include sister chromatid exchange and mechanisms related to DNA double strand break repair by homologous recombination such as single-strand annealing, synthesis- dependent strand annealing (SDSA), and gene conversion through a double- Holliday Junction intermediate or SDSA. In addition, non-homologous mitotic recombination is a possibility and can often be attributed to non-homologous end joining.
|
|
Simulated annealing (SA) is a probabilistic technique inspired by a heat treatment method in metallurgy. It is often used when the search space is discrete (e.g., all tours that visit a given set of cities). For problems where finding the precise global optimum is less important than finding an acceptable local optimum in a fixed amount of time, simulated annealing may be preferable to alternatives such as gradient descent.
|
|
Glass containers typically receive two surface coatings, one at the hot end, just before annealing and one at the cold end just after annealing. At the hot end a very thin layer of tin(IV) oxide is applied either using a safe organic compound or inorganic stannic chloride. Tin based systems are not the only ones used, although the most popular. Titanium tetrachloride or organo titanates can also be used.
|
|
When the material was annealed for periods from 1 to 48 hours , the properties developed a positive relationship starting at 475 K for all annealing periods, since the annealing induced structure disappears at that temperature. In this study, amorphous alloys demonstrated glass transition and a super cooled liquid region. Between 1988 and 1992, more studies found more glass-type alloys with glass transition and a super cooled liquid region.
|
|
Loading to the minimum power level listed in the reloading manual, instead of the maximum, can significantly increase case life. Slower powders generally also have lower pressure peaks, and may be a good choice. Annealing brass to make it softer and less brittle is fairly easy, but annealing cartridge cases is a more complex matter. Since the base of the case must be hard, it cannot be annealed.
|
|
Silicon is also printed as an organic precursor which is then converted by pyrolisis and annealing into crystalline silicon. PMOS but not CMOS is possible in printed electronics.
|
|
In 2014, carbon nanotube-reinforced graphene was made via spin coating and annealing functionalized carbon nanotubes. The resulting material was stronger, flexible and more conductive than conventional graphene.
|
|
To anneal glass, it is necessary to heat it to its annealing temperature, at which its viscosity, η, drops to 1013 Poise ("Poise" viscosity; 1 poise = 1 dyne-second/cm²). For most kinds of glass, this annealing temperature is in the range of 454–482 °C (850–900 °F), and is the so-called stress-relief point or annealing point of the glass. At such a viscosity, the glass is still too hard for significant external deformation without breaking, but it is soft enough to relax internal strains by microscopic flow in response to the intense stresses they introduce internally. The piece then heat-soaks until its temperature is even throughout and the stress relaxation is adequate.
|
|
Nitrogen-vacancy centers are typically produced from single substitutional nitrogen centers (called C or P1 centers in diamond literature) by irradiation followed by annealing at temperatures above 700 °C. A wide range of high-energy particles are suitable for such irradiation, including electrons, protons, neutrons, ions, and gamma photons. Irradiation produces lattice vacancies, which are a part of N-V centers. Those vacancies are immobile at room temperature, and annealing is required to move them.
|
|
The glass is then allowed to cool slowly over a specified time, soaking at specified temperature ranges which are essential to the annealing process. This prevents uneven cooling and breakage and produces a strong finished product. This cooling takes place normally for a period of 10–12 hours in 3 stages. The first stage- the rapid cool period is meant to place the glass into the upper end of the annealing range .
|
|
Prior to annealing, nearly all irradiated diamonds possess a characteristic absorption spectrum consisting of a fine line in the far red, at 741 nm – this is known as the GR1 line and is usually considered a strong indication of treatment. Subsequent annealing usually destroys this line, but creates several new ones; the most persistent of these is at 595 nm. Some irradiated diamonds are completely natural. One famous example is the Dresden Green Diamond.
|
|
D-Wave Two (project code name Vesuvius) is the second commercially available quantum computer, and the successor to the first commercially available quantum computer, D-Wave One. Both computers were developed by Canadian company D-Wave Systems. The computers are not general purpose, but rather are designed for quantum annealing. Specifically, the computers are designed to use quantum annealing to solve a single type of problem known as quadratic unconstrained binary optimization.
|
|
Quenching involves heating the iron-hydrogen alloy to create a different phase then quenching it in water or oil. This rapid cooling results in a hard but brittle martensitic structure. The iron-hydrogen alloy is then tempered, which is just a specialised type of annealing, to reduce brittleness. In this application the annealing (tempering) process transforms some of the dissolved hydrogen into elemental hydrogen and hence it reduces the internal stresses and defects.
|
|
Sendust, are manufactured as powder and sintered to shape. Many materials require careful heat treatment to reach their magnetic properties, and lose them when subjected to mechanical or thermal abuse. For example, the permeability of mu-metal increases about 40 times after annealing in hydrogen atmosphere in a magnetic field; subsequent sharper bends disrupt its grain alignment, leading to localized loss of permeability; this can be regained by repeating the annealing step.
|
|
NMath contains vector and matrix classes, complex numbers, factorizations, decompositions, linear programming, minimization, root-finding, structured and sparse matrix, least squares, polynomials, simulated annealing, curve fitting, numerical integration and differentiationing.
|
|
Finally, the process of the InN nanodots was in situ annealing at 500 °C for 10 min for recrystallization of InN nanodots and to evaporate the uncrystallized In droplets.
|
|
Otherwise, melanophlogite is thermally stable and its physical properties do not change upon 20-day annealing at 800 °C, but it converts to cristobalite after heating at temperatures above 900 °C.
|
|
This is then followed by a simulated annealing embedding of the candidate graph into the 3-dimensional torus. Ockwig et al. tile polyhedra to fill space and generate four-valent graphs.
|
|
This allows the function of the primer to be activated and deactivated through the use of UV irradiation (365 nm). Therefore, primers can be activated after the annealing temperature is reached.
|
|
When boxing a newly finished piece of glass for annealing a Glassblower may utilize Zetex gloves to hold the finished piece in transition from the knock off table to the annealer.
|
|
In the manufacture of glass, a lehr oven is a long kiln with an end-to-end temperature gradient, which is used for annealing newly made glass objects that are transported through the temperature gradient either on rollers or on a conveyor belt. The annealing renders glass into a stronger material with fewer internal stresses, and with a lower probability of breaking.McLellan, G.W. and Shand, E.B. Glass Engineering Handbook, 3rd Edition (1984) New York, McGraw Hill. ; pp. 000.
|
|
The three stages of the annealing process that proceed as the temperature of the material is increased are: recovery, recrystallization, and grain growth. The first stage is recovery, and it results in softening of the metal through removal of primarily linear defects called dislocations and the internal stresses they cause. Recovery occurs at the lower temperature stage of all annealing processes and before the appearance of new strain-free grains. The grain size and shape do not change.
|
|
Fast COLD-PCR differs from Full COLD-PCR in that the denaturation and intermediate annealing stages are skipped. This is because, in some cases, the preferential amplification of the mutant DNA is so great that ensuring the formation of the mutant/wildtype heteroduplex DNA is not needed. Thus the denaturation can occur at the Tc, proceed to primer annealing, and then polymerase-mediated extension. Each round of amplification will include these three stages in that order.
|
|
The neck of the case is placed in a propane torch flame and heated it until the crayon mark changes color, indicating the correct temperature. Once the correct temperature is reached the case is completely quenched in water to stop the annealing process at the desired hardness. Failing to keep the base of the case cool can anneal the case near the head, where it must remain hard to function properly.Gun Tests article on case annealing.
|
|
They worked naturally occurring metal deposits, such as hammering and annealing copper for ritual objects such as Mississippian copper plates and other decorations, but did not smelt iron or practice bronze metallurgy.
|
|
LeDock is based on simulated annealing and evolutionary optimization of the ligand pose and its rotatable bonds, using a physics/knowledge-based scoring scheme derived from years of prospective virtual screening campaigns.
|
|
Pyroxferroite can also be produced by annealing synthetic clinopyroxene at high pressures and temperatures. The mineral is metastable and gradually decomposes at ambient conditions, but this process can take billions of years.
|
|
The subsequent work in materials processing and controlled laser annealing resulted in developments reported in: ACS Nano; ACS Applied Nano Materials; Applied Physics Letters; Journal of Applied Physics; Materials Research Letters; MRS Communications.
|
|
Paradiseo-MO deals with single-solution based metaheuristics, it provides tools for the development of single solution-based metaheuristics: Hill climbing, Tabu search, Iterative Local Search (ILS), Simulated annealing, incremental evaluation, partial neighbourhood...
|
|
Sine performance of these devices is highly depended on active layer morphology, present research is continuing to investigate small molecule possibilities, and optimize device morphology through processes such as annealing for various materials.
|
|
By representing the to-be-determined structure as an assembly of independent scattering voxels, structure determination from FXS data is transformed into a global optimisation problem and can be solved using simulated annealing.
|
|
Further observations in the 1980s led to the proposal of alternate mechanisms for recombination such as the double-strand break model (by Jack Szostak, Frank Stahl, and others) and the single-strand annealing model. A third, the synthesis-dependent strand annealing model, did not involve Holliday junctions. The first experimental evidence for the structure of the Holliday junction came from electron microscopy studies in the late 1970s, where the four-arm structure was clearly visible in images of plasmid and bacteriophage DNA.
|
|
In metallurgy and materials science, annealing is a heat treatment that alters the physical and sometimes chemical properties of a material to increase its ductility and reduce its hardness, making it more workable. It involves heating a material above its recrystallization temperature, maintaining a suitable temperature for an appropriate amount of time and then cooling. In annealing, atoms migrate in the crystal lattice and the number of dislocations decreases, leading to a change in ductility and hardness. As the material cools it recrystallizes.
|
|
The mills throughout the works were two rolls high, and each had two pairs of standard housings. The annealing, pickling, cold rolls, tinning and assorting rooms, as well as the carpenters' and fitting shops, and the smithy, were situated on the higher level of the works. There were three reverberatory annealing furnaces, and two pickling machines. The tin-house contained fourteen tin-sets of the type known as the "Melingriffith Patent"; fourteen Richard Thomas and Company's cleaners, and four dusting-machines.
|
|
Amorphous boron contains B12 regular icosahedra that are randomly bonded to each other without long range order. Pure amorphous boron can be produced by thermal decomposition of diborane at temperatures below 1000 °C. Annealing at 1000 °C converts amorphous boron to β-rhombohedral boron. Amorphous boron nanowires (30–60 nm thick) or fibers can be produced by magnetron sputtering and laser- assisted chemical vapor deposition, respectively; and they also convert to β-rhombohedral boron nanowires upon annealing at 1000 °C.
|
|
For actuator applications, maximum rotation of magnetic moments leads to the highest possible magnetostriction output. This can be achieved by processing techniques such as stress annealing and field annealing. However, mechanical pre-stresses can also be applied to thin sheets to induce alignment perpendicular to actuation as long as the stress is below the buckling limit. For example, it has been demonstrated that applied compressive pre-stress of up to ~50 MPa can result in an increase of magnetostriction by ~90%.
|
|
The self-compensating nature of the defects would limit the possible hole concentrations, preventing further gains in TC. The major breakthrough came from improvements in post-growth annealing. By using annealing temperatures comparable to the growth temperature it was possible to pass the 110°K barrier. These improvements have been attributed to the removal of the highly mobile interstitial manganese. Currently, the highest reported values of TC in are around 173°K, still well below the much sought room- temperature.
|
|
FAST-ER detector is an improvement of the FAST detector using a metaheuristic algorithm, in this case simulated annealing. So that after the optimization, the structure of the decision tree would be optimized and suitable for points with high repeatability. However, since simulated annealing is a metaheurisic algorithm, each time the algorithm would generate a different optimized decision tree. So it is better to take efficiently large amount of iterations to find a solution that is close to the real optimal.
|
|
Alternatively, specialized reagents inhibit the polymerase's activity at ambient temperature, either by the binding of an antibody, or by the presence of covalently bound inhibitors that only dissociate after a high-temperature activation step. 'Hot-start/cold-finish PCR' is achieved with new hybrid polymerases that are inactive at ambient temperature and are only activated at elevated temperatures. In touchdown PCR, the annealing temperature is gradually decreased in later cycles. The annealing temperature in the early cycles is usually 3–5 °C above the standard Tm of the primers used, while in the later cycles it is a similar amount below the Tm. The initial higher annealing temperature leads to greater specificity for primer binding, while the lower temperatures permit more efficient amplification at the end of the reaction.
|
|
Whichever mode of deformation ultimately occurs is the result of a competition between processes that tend to localize strain, such as fracture propagation, and relaxational processes, such as annealing, that tend to delocalize strain.
|
|
The great success of this method in statistical mechanics has led to various generalizations such as the method of simulated annealing for optimization, in which a fictitious temperature is introduced and then gradually lowered.
|
|
There was little experience with annealing long lengths of copper. This resulted in inconsistent mechanical properties with brittle portions in the wire.Smith, pp. 1–2 An even bigger problem was caused by the joints.
|
|
Because ion implantation causes damage to the crystal structure of the target which is often unwanted, ion implantation processing is often followed by a thermal annealing. This can be referred to as damage recovery.
|
|
Kolchugino was founded in 1871 as a settlement next to copper-annealing and wire-producing plants belonging to a Muscovite merchant A. G. Kolchugin (hence, the name Kolchugino). It was granted town status in 1931.
|
|
At early time, placement of integrated circuits is handled by combinatorial approaches. When IC design was of thousand-gate scale, simulated annealingS. Kirkpatrick, C. D. G. Jr., and M. P. Vecchi. Optimization by Simulated Annealing.
|
|
Equiaxed crystals are crystals that have axes of approximately the same length. Equiaxed grains can in some cases be an indication for recrystallization. Equiaxed crystals can be achieved by heat treatment, namely annealing and normalizing.
|
|
It is often used when the search space is discrete (e.g., the traveling salesman problem). For problems where finding an approximate global optimum is more important than finding a precise local optimum in a fixed amount of time, simulated annealing may be preferable to exact algorithms such as gradient descent, Branch and Bound. The name of the algorithm comes from annealing in metallurgy, a technique involving heating and controlled cooling of a material to increase the size of its crystals and reduce their defects.
|
|
During the annealing process of die making, two main errors can occur, resulting in less than perfect dies. It is impossible to tell without expensive and lengthy tests whether these errors occurred, but they will lead to significantly weaker dies and a higher tendency to deteriorate quickly. The first thing which can happen to a die in this process what metallurgists call decarburization. Decarburization is the result of an improper mix of metals and chemicals in the annealing furnace where the dies are sent to soften.
|
|
The surface is flattened by annealing at high temperatures. Once a clean and well-defined surface is prepared, monolayers can be adsorbed on the surface by exposing it to a gas consisting of the desired adsorbate atoms or molecules. Often the annealing process will let bulk impurities diffuse to the surface and therefore give rise to a re-contamination after each cleaning cycle. The problem is that impurities which adsorb without changing the basic symmetry of the surface, cannot easily be identified in the diffraction pattern.
|
|
More recently, graphene nanoribbons were grown onto silicon carbide (SiC) substrates using ion implantation followed by vacuum or laser annealing. The latter technique allows any pattern to be written on SiC substrates with 5 nm precision.
|
|
For these reasons, a number of techniques have been developed to avoid or reduce built-in stress, such as annealing of cold- worked glass and metal parts, expansion joints in buildings, and roller joints for bridges.
|
|
A technique for protein sequences has been implemented in the software program SAGA (Sequence Alignment by Genetic Algorithm) and its equivalent in RNA is called RAGA. The technique of simulated annealing, by which an existing MSA produced by another method is refined by a series of rearrangements designed to find better regions of alignment space than the one the input alignment already occupies. Like the genetic algorithm method, simulated annealing maximizes an objective function like the sum-of-pairs function. Simulated annealing uses a metaphorical "temperature factor" that determines the rate at which rearrangements proceed and the likelihood of each rearrangement; typical usage alternates periods of high rearrangement rates with relatively low likelihood (to explore more distant regions of alignment space) with periods of lower rates and higher likelihoods to more thoroughly explore local minima near the newly "colonized" regions.
|
|
To avoid entrapment in local optima, a 'simulated annealing' approach can be used, whereby the algorithm is occasionally permitted to entertain sub-optimal candidate trees, with a probability related to how far they are from the optimum.
|
|
Then, as the mixture cools, both of these become templates for annealing of new primers, and the polymerase extends from these. As a result, the number of copies of the target region doubles each round, increasing exponentially.
|
|
The quantum approximate optimization algorithm is a toy model of quantum annealing which can be used to solve problems in graph theory. The algorithm makes use of classical optimization of quantum operations to maximize an objective function.
|
|
This cycle is followed by template switching and annealing of the short fragments obtained from the earlier primer extension to other single stranded DNA fragments. This process is repeated until full length single stranded DNA is obtained.
|
|
This pathway is labeled in the figure as the DHJ (double-Holliday junction) pathway. The NCO recombinants (illustrated on the left in the figure) are produced by a process referred to as “synthesis dependent strand annealing” (SDSA).
|
|
Quantum information processing, also called quantum computing, theoretically is known to offer dramatic speed-ups and more complete answers for some combinatorial computing problems. Quantum annealing is a branch of quantum computing whose advantages over classical computing are actively being investigated. In quantum annealing, problems are encoded into the lowest energy state of a physical quantum system. Applications currently under study at the QCC include big data analysis, verification and validation of cyber-physical systems, pattern identification and classification, and optimization and machine learning, any of which may support breakthroughs in multiple industries and government.
|
|
Usually, a set of individually designed oligonucleotides is made on automated solid-phase synthesizers, purified and then connected by specific annealing and standard ligation or polymerase reactions. To improve specificity of oligonucleotide annealing, the synthesis step relies on a set of thermostable DNA ligase and polymerase enzymes. To date, several methods for gene synthesis have been described, such as the ligation of phosphorylated overlapping oligonucleotides, the Fok I method and a modified form of ligase chain reaction for gene synthesis. Additionally, several PCR assembly approaches have been described.
|
|
In order to apply the simulated annealing method to a specific problem, one must specify the following parameters: the state space, the energy (goal) function , the candidate generator procedure , the acceptance probability function , and the annealing schedule AND initial temperature . These choices can have a significant impact on the method's effectiveness. Unfortunately, there are no choices of these parameters that will be good for all problems, and there is no general way to find the best choices for a given problem. The following sections give some general guidelines.
|
|
There is growing demand for cesium and its compounds for energy conversion devices such as magneto-hydrodynamic generators, thermionic emitters, and fuel cells. Relatively effective polymer solar cells are built by thermal annealing of cesium carbonate. Cesium carbonate increases the energy effectiveness of the power conversion of solar cells and enhances the life times of the equipment. The studies done on UPS and XPS reveal that the system will do less work due to the thermal annealing of the Cs2CO3 layer. Cesium carbonate breaks down into Cs2O and Cs2O2 by thermal evaporation.
|
|
At the annealing point (η = 1013 Poise), stresses relax within several minutes, while at the strain point (η = 1014.5 Poise) stresses relax within several hours.Werner Vogel: "Glass Chemistry"; Springer-Verlag Berlin and Heidelberg GmbH & Co. K; 2nd revised edition (November 1994), Stresses acquired at temperatures above the strain point, and not relaxed by annealing, remain in the glass indefinitely and may cause either short-term or much delayed failure. Stresses resulting from cooling too rapidly below the strain point largely are considered temporary, although they may be adequate to promote short-term failure.
|
|
Such sensitization of austenitic stainless steels can readily occur because of temperature service requirements, as in steam generators, or as a result of subsequent welding of the formed structure. Several methods have been used to control or minimize the intergranular corrosion of susceptible alloys, particularly of the austenitic stainless steels. For example, a high-temperature solution heat treatment, commonly termed solution-annealing, quench-annealing or solution- quenching, has been used. The alloy is heated to a temperature of about 1,060 °C to 1,120 °C and then water quenched.
|
|
One side of the ring is large enough to admit double stranded DNA, but the other end can only accommodate single stranded DNA, therefore providing details into the exo mechanism of action. This process results in single stranded 3’ overhangs on the linear DNA. Subsequently, λ beta, a member of a recombinase family, binds to the 3’ overhangs and mediates annealing to the complementary E. coli DNA. This process occurs through invasion of the single stranded 3’ overhang into the complementary target DNA on the lagging strand during DNA synthesis, allowing beta-facilitated annealing.
|
|
Assembly of Protein Tertiary Structures from Fragments with Similar Local Sequences using Simulated Annealing and Bayesian Scoring Functions. J Mol Biol 268, 209-225.Bujnicki, J. (2006) Protein Structure Prediction by Recombination of Fragments. ChemBioChem. 7, 19-27.
|
|
In polymerase chain reaction (PCR) experiments, the GC-content of short oligonucleotides known as primers is often used to predict their annealing temperature to the template DNA. A higher GC-content level indicates a relatively higher melting temperature.
|
|
Nanocrystalline metals can be produced by rapid solidification from the liquid using a process such as melt spinning. This often produces an amorphous metal, which can be transformed into an nanocrystalline metal by annealing above the crystallization temperature.
|
|
Annealing temperatures for each of the primer sets must be optimized to work correctly within a single reaction, and amplicon sizes, i.e., their base pair length, should be different enough to form distinct bands when visualized by gel electrophoresis.
|
|
It is also possible to employ mechanisms that search more directly for energy minima, either instead of or in conjunction with physical simulation. Such mechanisms, which are examples of general global optimization methods, include simulated annealing and genetic algorithms.
|
|
These furnaces had underground flues and chimneys with air holes to provide a strong air draught to control heat. Fritting, pre- heating pots and annealing processes were undertaken in different sections of the furnace, elevated above the heat source.
|
|
In case of cryorolling, the deformation in the strain hardened metals is preserved as a result of the suppression of the dynamic recovery. Hence large strains can be maintained and after subsequent annealing, ultra-fine-grained structure can be produced.
|
|
In 2018 Rosatom announced it had developed a thermal annealing technique for RPVs which ameliorates radiation damage and extends service life by between 15 and 30 years. This had been demonstrated on unit 1 of the Balakovo Nuclear Power Plant.
|
|
SEM micrograph of lamellar pearlite in a eutectoid (0.8% carbon) steel after annealing. Nital etch. Nital is a solution of nitric acid and alcohol commonly used for etching of metals. It is especially suitable for revealing the microstructure of carbon steels.
|
|
Medium temperature processes include melting plastics and some non-metals for casting or reshaping, as well as annealing, stress-relieving and heat-treating metals. High-temperature processes include steelmaking, brazing, welding, casting metals, cutting, smelting and the preparation of some chemicals.
|
|
Algorithms such as simulated annealing have strong theoretical convergence properties for some scheduling of the temperature to infinity. Such scheduling cannot be realised in practice. Adding one node is necessary, graphs without auxiliary nodes can only represent binary interactions between variables.
|
|
The application of multiple scans is shown above to distinguish reversible from irreversible changes. Thermal cycling and annealing steps can be added to provide complex thermal programs to test various attributes of a material as more becomes known about the material.
|
|
One prominent method for preparing silicon on insulator (SOI) substrates from conventional silicon substrates is the SIMOX (separation by implantation of oxygen) process, wherein a buried high dose oxygen implant is converted to silicon oxide by a high temperature annealing process.
|
|
The dislocations are caused by neutron passage through the graphite. Windscale had a program of regular annealing in place to release accumulated Wigner energy, but since the effect was not anticipated during the construction of the reactor, and since the reactor was cooled by ordinary air in an open cycle, the process could not be reliably controlled, and led to a fire. The second generation of UK gas-cooled reactors, the AGRs, also operate above the annealing temperature of graphite. Berkeley professor Richard A. Muller has called pebble-bed reactors "in every way ... safer than the present nuclear reactors".
|
|
In 1847, he took out patents for the corrugated-plate carriage wheel and the curved corrugated-plate carriage wheel, and the following year for the process of annealing carriage wheels. This consisted of placing the wheels, soon after they were cast, in a heated furnace, where they were subjected to a further gradual increase of temperature, and were then slowly cooled for three days. The discovery of this process of annealing, as applied to chilled cast-iron wheels, marked an era in the history of railroads. It enabled trains to safely increase both loads and speed.
|
|
Adding pinning points that inhibit the motion of dislocations, such as alloying elements, can introduce stress fields that ultimately strengthen the material by requiring a higher applied stress to overcome the pinning stress and continue dislocation motion. The effects of strain hardening by accumulation of dislocations and the grain structure formed at high strain can be removed by appropriate heat treatment (annealing) which promotes the recovery and subsequent recrystallization of the material. The combined processing techniques of work hardening and annealing allow for control over dislocation density, the degree of dislocation entanglement, and ultimately the yield strength of the material.
|
|
MARXAN is software designed to aid systematic reserve design on conservation planning. With the use of stochastic optimisation routines (Simulated Annealing) it generates spatial reserve systems that achieve particular biodiversity representation goals with reasonable optimality. Computationally, MARXAN provides solutions to a conservation version of the 0-1 knapsack problem, where the objects of interest are potential reserve sites with given biological attributes. The simulated annealing algorithm attempts to minimise the total cost of the reserve system, while achieving a set of conservation goals (typically that a certain percentage of each geographical/biological feature is represented by the reserve system).
|
|
The time necessary for this step varies depending on the type of glass and its maximum thickness. The glass then is permitted to cool at a predetermined rate until its temperature passes the strain point (η = 1014.5 Poise), below which even microscopic internal flow effectively stops and annealing stops with it. It then is safe to cool the product to room temperature at a rate limited by the heat capacity, thickness, thermal conductivity, and thermal expansion coefficient of the glass. After annealing is complete the material can be cut to size, drilled, or polished without risk of its internal stresses shattering it.
|
|
On the exact search algorithms Mallba provides branch-and-bound and dynamic-optimization skeletons. For local search heuristics Mallba supports: hill climbing, metropolis, simulated annealing, and tabu search; and also population based heuristics derived from evolutionary algorithms such as genetic algorithms, evolution strategy, and others (CHC). The hybrid skeletons combine strategies, such as: GASA, a mixture of genetic algorithm and simulated annealing, and CHCCES which combines CHC and ES. The skeletons are provided as a C++ library and are not nestable but type safe. A custom MPI abstraction layer is used, NetStream, which takes care of primitive data type marshalling, synchronization, etc.
|
|
Strip steel or cold rolled strip is a steel product that is produced from a hot rolled strip that has been pickled. The coil is then reduced by a single stand cold roll steel mill straight away or reversing mill or in a tandem mill consisting of several single stands in a series. The strip is reduced to approximately final thickness by cold-rolling directly, or with the inclusion of an annealing operation at some intermediate thickness to facilitate further cold reduction or to obtain mechanical properties desired in the finished product. High carbon strip steel requires additional annealing and cold reduction operations.
|
|
A 2010 paper Supporting information suggested that current models that assume pure phases and discrete interfaces might fail given the absence of pure amorphous regions. Since current models assume phase separation at interfaces without any consideration for phase purity, the models might need to be changed. The thermal annealing procedure varies depending on precisely when it is applied. Since vertical species migration is partly determined by the surface tension between the active layer and either air or another layer, annealing before or after the deposition of additional layers (most often the metal cathode) affects the result.
|
|
Figure 3: a) random copolymer blend with annealing b) gradient copolymer blend with annealing For the compatiabilization of immiscible blends, the gradient copolymer can be used by improving mechanical and optical properties of immiscible polymers and decreasing its dispersed phase to droplet size. The compatibilization has been tested by reduction in interfacial tension and steric hindrance against coalescence. This application is not available for block and graft copolymer because of its very low critical micelle concentration (cmc). However, the gradient copolymer, which has higher cmc and exhibits a broader interfacial coverage, can be applied to effective blend compatibilizers.
|
|
Cold-worked steel normally tends to possess increased hardness and decreased ductility, making it difficult to work. Process annealing tends to improve these characteristics. This is mainly carried out on cold-rolled steel like wire-drawn steel, centrifugally cast ductile iron pipe etc.
|
|
In 2018 Rosatom announced it had developed a thermal annealing technique for reactor pressure vessels which ameliorates radiation damage and extends service life by between 15 and 30 years. This had been demonstrated on unit 1 of the Balakovo Nuclear Power Plant.
|
|
Simulated annealing interprets slow cooling as a slow decrease in the probability of accepting worse solutions as it explores the solution space. Accepting worse solutions is a fundamental property of metaheuristics because it allows for a more extensive search for the optimal solution.
|
|
Einsteinium(III) oxide can be obtained by annealing einsteinium(III) nitrate in sub-microgram quantities.R. G. Haire, R. D. Baybarz: "Identification and Analysis of Einsteinium Sesquioxide by Electron Diffraction", in: Journal of Inorganic and Nuclear Chemistry, 1973, 35 (2), S. 489–496; .
|
|
There are currently two main approaches to physically implementing a quantum computer: analog and digital. Analog approaches are further divided into quantum simulation, quantum annealing, and adiabatic quantum computation. Digital quantum computers use quantum logic gates to do computation. Both approaches use qubits.
|
|
Ge-V can be created during the diamond growth, or by ion implantation and subsequent annealing at 800 °C. The former way results in lower lattice strain, as revealed by the spread in the position and width of the Ge-V ZPL.
|
|
Like all intermediate filaments, keratin proteins form filamentous polymers in a series of assembly steps beginning with dimerization; dimers assemble into tetramers and octamers and eventually, if the current hypothesis holds, into unit-length-filaments (ULF) capable of annealing end-to-end into long filaments.
|
|
Therefore a quantum annealer with 5893 qubits that can be coupled together arbitrarily with each qubit coupled simultaneously to at most three other qubits, would be able to factor RSA-230. The amount of time this annealing would take is still an open question.
|
|
The neutral flame is the flame in which the amount of oxygen is precisely enough for burning, and neither oxidation nor reduction occurs. A flame with a good balance of oxygen is clear blue. The reducing and neutral flames are useful in soldering and annealing.
|
|
Beta is a protein that binds to single stranded DNA and assists homologous recombination by promoting annealing between the homology regions of the inserted DNA and the chromosomal DNA. Gam functions to protect the DNA insert from being destroyed by native nucleases within the cell.
|
|
Unlike VLS, the catalytic seed remains in solid state when subjected to high temperature annealing of the substrate. This such type of synthesis is widely used to synthesise metal silicide/germanide nanowires through VSS alloying between a copper substrate and a silicon/germanium precursor.
|
|
XeCl-ELA succeeds in crystallizing a-Si (thickness ranges from 500-10000A) into p-Si without heating the substrates. Sameshima, T., S. Usui, and M. Sekiya. "XeClExcimer Laser Annealing Used in the Fabrication of Poly-Si TFT's." IEEE Electron Device Letters 07.05 (1986): 276-78.
|
|
During normal meiosis Sgs1(BLM) is responsible for directing recombination towards the alternate formation of either early NCOs or Holliday junction joint molecules, the latter being subsequently resolved as COs. In the plant Arabidopsis thaliana, homologs of the Sgs1(BLM) helicase act as major barriers to meiotic CO formation. These helicases are thought to displace the invading strand allowing its annealing with the other 3’overhang end of the DSB, leading to NCO recombinant formation by a process called synthesis dependent strand annealing (SDSA) (see Genetic recombination and Figure in this section). It is estimated that only about 4% of DSBs are repaired by CO recombination.
|
|
With the discovery of nanosecond laser annealing, Narayan has pioneered developments in laser- solid interactions and transient thermal processing of nanomaterials and epitaxial thin films. With the development of pulsed laser deposition technique and domain matching epitaxy paradigm, he formed relaxed stoichiometric thin films on industrially relevant substrates across the misfit scale. These developments in materials fabrication technology resulted in fabrication of novel multifunctional materials like supersaturated semiconductor alloys, metal-ceramic nanocomposites, and laser-diffused solar cells. While working on laser annealing of semiconductor alloys, Narayan touted it as the technique of choice for achieving temporal and spatial control on the dopant concentration in doped semiconductors.
|
|
MMEJ is completely independent from classical NHEJ and does not rely on NHEJ core factors such as Ku protein, DNA-PK, or Ligase IV. In MMEJ, repair of the DSB is initiated by end resection by the MRE nuclease, leaving single stranded overhangs. These single stranded overhangs anneal at microhomologies, which are short regions of complementarity, often 5–25 base pairs, between the two strands. A specialized form of MMEJ, called polymerase theta-mediated end-joining (TMEJ), is able to repair breaks using ≥1 bp of homology. The helicase domain of DNA polymerase theta possesses ATP-dependent single-strand annealing activity and may promote annealing of microhomologies.
|
|
Blends such as P3HT:PCBM seem to benefit from thermal annealing procedures, while others, such as PTB7:PCBM, seem to show no benefit. In P3HT the benefit seems to come from an increase of crystallinity of the P3HT phase which is generated through an expulsion of PCBM molecules from within these domains. This has been demonstrated through studies of PCBM miscibility in P3HT as well as domain composition changes as a function of annealing times.; The above hypothesis based on miscibility does not fully explain the efficiency of the devices as solely pure amorphous phases of either donor or acceptor materials never exist within bulk heterojunction devices.
|
|
During normal meiosis Sgs1(BLM) is responsible for directing recombination towards the alternate formation of either early non-crossovers or Holliday junction joint molecules, the latter being subsequently resolved as crossovers. In the plant Arabidopsis thaliana, homologs of the Sgs1(BLM) helicase act as major barriers to meiotic crossover formation. These helicases are thought to displace the invading strand allowing its annealing with the other 3’overhang end of the double-strand break, leading to non-crossover recombinant formation by a process called synthesis-dependent strand annealing (SDSA) (see Wikipedia article “Genetic recombination”). It is estimated that only about 5% of double-strand breaks are repaired by crossover recombination.
|
|
Despite the evidence supporting DNA duplex models alternative models were subsequently proposed during the 1980s and into the 2000s. Due to lack of evidence and contradiction of other experiments, these have been rejected by the scientific community as of insufficient evidence and of attempting to solve a solved problem. In 2009, You Cheng Xu noted that brief re-annealing times (i.e. 20–30 minutes) resulted in anomalous structures which did not co-migrate with routinely prepared DNA topoisomers, while prolonged re-annealing times (in his case, 72 hours at 4º) resulted in structures which did co-migrate with the topoisomers, suggesting normal base-pairing.
|
|
Because it is unlikely that both single stranded and double stranded RNA's are encapsidated within the viral ribonucleoprotein, it is theorized that the double stranded RNA sometimes present in gel electrophoresis results comes from the annealing in vitro of single stranded RNA's that possess opposite polarities.
|
|
"Quantum Error Correction", by D.A. Lidar and T.A. Brun (editors), Cambridge University Press (2013). QCC researchers and their collaborators have developed methods to counteract decoherence in quantum annealers by combining quantum error correction with energy penalties that suppress decoherence into a single quantum annealing correction method.
|
|
Pulverized coal burners have a wide range of uses in industrial production and daily life, such as providing heat for boilers, hot mix asphalt plant, cement kiln, metal furnace, annealing, quenching furnace, precision casting shell burning furnace, melting furnace, forging furnace and other heating furnace or kiln.
|
|
Above and below the lock and weir are permanent moorings. The Riverside Inn and Saltford Marina are also close by. A branch of the river runs behind "Brass Mill Island", named for the annealing ovens of the former brass mill. The mill closed in the 1840s.
|
|
SSA is employed as a repair pathway when a double-strand break arises between direct repeat sequences in DNA. SSA involves single-strand resection, annealing of the repeats, flap removal, gap filling and ligation. In M. smegmatis the SSA pathway depends on the RecBCD helicase-nuclease.
|
|
In this process copper(I) and tetrahydroaluminate react to produce molecular copper hydride and triiodoaluminium adducts. The molecular copper hydride is precipitated into amorphous copper hydride with the addition of diethyl ether. Amorphous copper hydride is converted into the Wurtz phase by annealing, accompanied by some decomposition.
|
|
Graphite moderated reactors were involved in two of the best known nuclear disasters: an untested graphite annealing process contributed to the Windscale fire (but the graphite itself did not catch fire), while a graphite fire during the Chernobyl disaster contributed to the spread of radioactive material.
|
|
The extracted DNA must be quantified to “ensure the optimal amount of DNA template is added to a PCR”. PCR, Polymerase chain reaction, is the technology used for the purpose of copying particular DNA in a test tube. This method includes three steps; denaturation, annealing, extension.
|
|
On elongation, the effects were minimal; on annealing negligible. This might be due to an actual difference in molecular interactions of cytochalasin B during those three steps or simply due to the fact that the lag phase is the rate-determining step in the overall polymerization.
|
|
A blow increased the temperature sufficiently to produce a friction weld at that spot. Forging continued until the steel was cold, producing some central annealing. The sword was long. The Chiusian sword was created from a single bloom by forging from a temperature of 1237 °C.
|
|
This process of fragments annealing template DNA is known as template switching. These annealed fragments will then serve as primers for further extension. This method is carried out until the parental length chimeric gene sequence is obtained. Execution of this method only requires flanking primers to begin.
|
|
In April 2016 the 18-bit number 200 099 was factored using quantum annealing on a D-Wave 2X quantum processor. Shortly after, 291 311 was factored using NMR at higher than room temperature. In late 2019, an industry collaboration found 1,099,551,473,989 is equal to 1,048,589 multiplied by 1,048,601.
|
|
In the process of annealing glass, the rate of cooling depends upon the casting thickness of the slab of glass, ranging from tens of degrees-Celsius per hour (for thin-cast slabs of glass) to fractions of a degree-Celsius per hour (for thick-cast slabs of glass).
|
|
Anepigraphic coin : Coin without an inscription. Many ancient coins used only a simple picture of an animal to show value or weight. Annealing : Process of heating and cooling metal in order to relieve stresses. This is often done with coin blanks to make the metal less brittle before striking.
|
|
P. Boehm reported producing monolayer flakes of reduced graphene oxide in 1962. Rapid heating of graphite oxide and exfoliation yields highly dispersed carbon powder with a few percent of graphene flakes. Reduction of graphite oxide monolayer films, e.g. by hydrazine with annealing in argon/hydrogen also yielded graphene films.
|
|
The annealing step used to recrystallize or heal silicon layers amorphized during ion implantation is also considered one type of Solid Phase Epitaxy. The Impurity segregation and redistribution at the growing crystal-amorphous layer interface during this process is used to incorporate low-solubility dopants in metals and Silicon.
|
|
The acidic filtrates are partially neutralized with sodium hydroxide to pH 3–4. Thorium precipitates out of solution as hydroxide and is removed. After that, the solution is treated with ammonium oxalate to convert rare earths to their insoluble oxalates. The oxalates are converted to oxides by annealing.
|
|
Supramolecular chemistry was investigated, using donor and acceptor molecules that assemble upon spin casting and heating. Most supramolecular assemblies employ small molecules. Donor and acceptor domains in a tubular structure appear ideal for organic solar cells. Diblock polymers containing fullerene yield stable organic solar cells upon thermal annealing.
|
|
The connection of the molecules is activated over different annealing steps, so called post exposure bake (peb). Using SU-8 can achieve a high bonding yield. In addition, the substrate flatness, clean room conditions and the wettability of the surface are important factors to achieve good bond results.
|
|
'' Because conventional substrates cannot withstand high annealing temperatures, the deposition process must be completed under relatively low temperatures. Chemical vapor deposition and physical vapor deposition (usually sputtering) are applied. The first solution-processed TTFTs, based on zinc oxide, were reported in 2003 by researchers at Oregon State University.Wager, John.
|
|
The next (soaking/annealing) zone typically offers 12 burners. Air is sucked from the bottom of the bed of mixed material throughout the sintering machine. Fire penetrates the mixed material gradually, until it reaches the hearth layer. This end point of burning is called burn through point (BTP).
|
|
Adaptive simulated annealing (ASA) is a variant of simulated annealing (SA) algorithm in which the algorithm parameters that control temperature schedule and random step selection are automatically adjusted according to algorithm progress. This makes the algorithm more efficient and less sensitive to user defined parameters than canonical SA. These are in the standard variant often selected on the basis of experience and experimentation (since optimal values are problem dependent), which represents a significant deficiency in practice. The algorithm works by representing the parameters of the function to be optimized as continuous numbers, and as dimensions of a hypercube (N dimensional space). Some SA algorithms apply Gaussian moves to the state, while others have distributions permitting faster temperature schedules.
|
|
For many alloys, including carbon steel, the crystal grain size and phase composition, which ultimately determine the material properties, are dependent on the heating rate and cooling rate. Hot working or cold working after the annealing process alters the metal structure, so further heat treatments may be used to achieve the properties required. With knowledge of the composition and phase diagram, heat treatment can be used to adjust from harder and more brittle to softer and more ductile. In the case of ferrous metals, such as steel, annealing is performed by heating the material (generally until glowing) for a while and then slowly letting it cool to room temperature in still air.
|
|
The damage caused can be repaired by subjecting the crystal to high temperature. This process is called annealing. Furnace anneals may be integrated into other furnace processing steps, such as oxidations, or may be processed on their own. Furnace anneals are performed by equipment especially built to heat semiconductor wafers.
|
|
Hydrogenation of graphene on substrate affects only one side, preserving hexagonal symmetry. One-sided hydrogenation of graphene is possible due to the existence of ripplings. Because the latter are distributed randomly, the obtained material is disordered in contrast to two-sided graphane. Annealing allows the hydrogen to disperse, reverting to graphene.
|
|
Defective plates were discarded, and the rest passed to the pickling department. In the pickling department, the plates were immersed in baths of acid (to remove scale, i.e., oxide), then in water (washing them). After inspection they were placed in an annealing furnace, where they were heated for 10–14 hours.
|
|
There are many types of heat treating processes available to iron-hydride alloy. The most common are annealing, quenching, and tempering. Heat treatment is effective on compositions above the saturated composition of 2 ppm hydrogen, aiding to prevent hydrogen embrittlement. Non- saturated iron hydride does not benefit from heat treatment.
|
|
Broadly, modern glass container factories are three-part operations: the batch house, the hot end, and the cold end. The batch house handles the raw materials; the hot end handles the manufacture proper—the forehearth, forming machines, and annealing ovens; and the cold end handles the product-inspection and packaging equipment.
|
|
Here, the influence of cytochalasin B strongly depends on the overall conditions for elongation. If ideal physiological conditions are present, the inhibitory influence of cytochalasin B is minuscule. If the conditions are less optimal, elongation can be inhibited by up to 90 percent. Annealing is the last step in polymerization.
|
|
A rolling mill was then erected at 'Het Funen', an area just east of the existing buildings. The rolling mill was 168 feet long and 118 feet wide. The machinery was made by Van Vlissingen en Dudok van Heel. There were 12 annealing and smelt ovens, and 5 pairs of rolls.
|
|
Starting with the amorphous film, rather than directly depositing crystals, produces a product with a superior structure and a desired smoothness.Hatalis, Miltiadis K., and David W. Greve. "Large Grain Polycrystalline Silicon By Low-Temperature Annealing Of Low-Pressure Chemical Vapor Deposited Amorphous Silicon Films." Applied Physics 63.07 (1988): 2266. Print.
|
|
Rigid copper, rigid due to the work hardening of the drawing process, cannot be bent and must use elbow fittings to go around corners or around obstacles. If heated and allowed to cool in a process called annealing, rigid copper will become soft and can be bent/formed without cracking.
|
|
CO recombination is thought to occur by the Double Holliday Junction (DHJ) model, illustrated on the right, above. NCO recombinants are thought to occur primarily by the Synthesis Dependent Strand Annealing (SDSA) model, illustrated on the left, above. Most recombination events appear to be the SDSA type. The MLH1-MLH3 heterodimers promote crossovers.
|
|
There are several methods for enumerating zeolite frameworks. The method of Earl et al. uses simulated annealing to arrange a fixed number of tetrahedral atoms under periodic symmetry constraints. The method of Treacy and Rivin uses combinatorial enumeration to identify four-valent graphs under fixed symmetry and fixed number of tetrahedral atoms.
|
|
D-Wave TwoX "Washington" quantum annealing processor chip mounted and wire- bonded in a sample holder. This chip was introduced in 2015 and includes 128,472 Josephson junctions. The Josephson junction count is the number of Josephson junctions on a superconducting integrated circuit chip. Josephson junctions are active circuit elements in superconducting circuits.
|
|
Heat treatment techniques include annealing, case hardening, precipitation strengthening, tempering, and quenching. Although the term "heat treatment" applies only to processes where the heating and cooling are done for the specific purpose of altering properties intentionally, heating and cooling often occur incidentally during other manufacturing processes such as hot forming or welding.
|
|
Excess tellurium deposited during this process can be dissolved off with sulfuric acid. By annealing molybdenum film in a tellurium vapour at 850 to 870 °C for several hours, a thin layer of MoTe2 is formed. An amorphous form can be produced by sonochemically reacting molybdenum hexacarbonyl with tellurium dissolved in decalin.
|
|
Work by Leseigneur and coworkers has been done to carefully control some of these parameters in order to get more consistent and better microstructures in ODS steels.Laurent-Brocq, M., et al. "Influence of ball-milling and annealing conditions on nanocluster characteristics in oxide dispersion strengthened steels." Acta Materialia 60.20 (2012): 7150-7159.
|
|
RNA encapsulation involves detection of the psi recognition element by the protein NCp7. NCp7 contains two successive zinc fingers which are linked by a stretch of basic residues. Their function is to activate annealing of primer tRNA to the initiation site (where reverse transcription occurs). During this process, GSL3 interacts with NCp7 specifically.
|
|
This involves dipping the plates in sulfuric acid for five minutes. The pickling turns the scales into a greenish-black slime which is removed via annealing. The plates are annealed for approximately 10 hours and then allowed to slowly cool. At this point the plates are known as pickled and annealed black plates.
|
|
Mol Microbiol. 2000 Apr;36(2):437-46. This repair of double-strand breaks is facilitated by the gene 2.5 protein that promotes the annealing of homologous complementary strands of DNA.Yu M, Masker W. T7 single strand DNA binding protein but not T7 helicase is required for DNA double strand break repair.
|
|
Hatalis, M.K., and D.W. Greve. "High-Performance Thin-Film Transistors In Low-Temperature Crystallized LPCVD Amorphous Silicon Films." IEEE Electron Device Letters 08 (1987): 361–64. Print. In 1988, researchers discovered that further lowering temperature during annealing, together with advanced plasma-enhanced chemical vapor deposition (PECVD),could facilitate even higher degrees of conductivity.
|
|
Infrared heating is also becoming more popular in industrial manufacturing processes, e.g. curing of coatings, forming of plastics, annealing, plastic welding, and print drying. In these applications, infrared heaters replace convection ovens and contact heating. Efficiency is achieved by matching the wavelength of the infrared heater to the absorption characteristics of the material.
|
|
This island formation reduces the elastic energy. Overgrown with material B, the wetting layer forms a quantum well in case material A has a lower bandgap than B. In this case, the formed islands are quantum dots. Further annealing can be used to modify the physical properties of the wetting layer/quantum dot .
|
|
When choosing the candidate generator one must also try to reduce the number of "deep" local minima—states (or sets of connected states) that have much lower energy than all its neighbouring states. Such "closed catchment basins" of the energy function may trap the simulated annealing algorithm with high probability (roughly proportional to the number of states in the basin) and for a very long time (roughly exponential on the energy difference between the surrounding states and the bottom of the basin). As a rule, it is impossible to design a candidate generator that will satisfy this goal and also prioritize candidates with similar energy. On the other hand, one can often vastly improve the efficiency of simulated annealing by relatively simple changes to the generator.
|
|
11281130, 1970 S. A. Metz and F. A. Smidt, Jr. irradiated nickel and vanadium foils in air with a pulsed laser at a low power density and observed voids and vacancy loops after annealing the foils, suggesting that a high concentration of vacancies was created by the stress wave. These vacancies subsequently aggregated during post-iradiation annealing into the observed voids in nickel and dislocation loops in vanadium. In 1971, researchers at Battelle Memorial Institute in Columbus, Ohio began investigating whether the laser shocking process could improve metal mechanical properties using a high energy pulsed laser. In 1972, the first documentation of the beneficial effects of laser shocking metals was published, reporting the strengthening of aluminum tensile specimens using a quartz overlay to confine the plasma.
|
|
In this regard, using trioctylphosphine oxide (TOP) as the phosphorus precursor with an approximately six-fold larger molecular footprint than DPP, the dopant dose can be modulated in the reduction of six times accordingly. Moreover, the doping profiles can be readily tuned through optimization of the annealing conditions. In this case, the high surface doping density with sharp spatial decay can be obtained by using this MLD method with low anneal temperatures and short times for the formation of USJs. The ability to controllably tune the dopant dose through the structural design of the precursor and to control the dopant profile by the annealing conditions present a unique aspect of the MLD process for attaining the desired dopant dose and profile.
|
|
Boron nitride is produced synthetically. Hexagonal boron nitride is obtained by the reacting boron trioxide (B2O3) or boric acid (H3BO3) with ammonia (NH3) or urea (CO(NH2)2) in a nitrogen atmosphere: :B2O3 \+ 2 NH3 → 2 BN + 3 H2O (T = 900 °C) :B(OH)3 \+ NH3 → BN + 3 H2O (T = 900 °C) :B2O3 \+ CO(NH2)2 → 2 BN + CO2 \+ 2 H2O (T > 1000 °C) :B2O3 \+ 3 CaB6 \+ 10 N2 → 20 BN + 3 CaO (T > 1500 °C) The resulting disordered (amorphous) boron nitride contains 92–95% BN and 5–8% B2O3. The remaining B2O3 can be evaporated in a second step at temperatures in order to achieve BN concentration >98%. Such annealing also crystallizes BN, the size of the crystallites increasing with the annealing temperature.
|
|
Exposure of uranium metal to hydrogen leads to hydrogen embrittlement. Hydrogen diffuses through metal and forms a network of brittle hydride over the grain boundaries. Hydrogen can be removed and ductility renewed by annealing in vacuum. Uranium metal heated to 250 to 300 °C (482 to 572 °F) reacts with hydrogen to form uranium hydride.
|
|
Amorphous silicon can be transformed to crystalline silicon using well-understood and widely implemented high-temperature annealing processes. The typical method used in industry requires high-temperature compatible materials, such as special high temperature glass that is expensive to produce. However, there are many applications for which this is an inherently unattractive production method.
|
|
Many policy search methods may get stuck in local optima (as they are based on local search). A large class of methods avoids relying on gradient information. These include simulated annealing, cross-entropy search or methods of evolutionary computation. Many gradient- free methods can achieve (in theory and in the limit) a global optimum.
|
|
The five key points to the design are: (i) an intrinsic tunneling barrier, (ii) delta-doped injectors, (iii) offset of the delta- doping planes from the heterojunction interfaces, (iv) low temperature molecular beam epitaxial growth (LTMBE), and (v) postgrowth rapid thermal annealing (RTA) for activation of dopants and reduction of density of point defects.
|
|
A variety of related chelate complexes have been developed, including gadodiamide. Reduced gadolinium compounds are known, especially in the solid state. Gadolinium(II) halides are obtained by heating Gd(III) halides in presence of metallic Gd in tantalum containers. Gadolinium also form sesquichloride Gd2Cl3, which can be further reduced to GdCl by annealing at .
|
|
Visual evidence of aluminum alloying into < 1 1 1 > silicon is due to excessive aluminum annealing. The integrated circuit aluminum layer was removed via chemical etching to reveal this detail. A metal gate, in the context of a lateral metal-oxide-semiconductor (MOS) stack, is just that—the gate material is made from a metal.
|
|
Vacuum furnaces capable of temperatures above 1200 °C are used in various industry sectors such as electronics, medical, crystal growth, energy and artificial gems. The processing of high temperature materials, both of metals and nonmetals, in a vacuum environment allows annealing, brazing, purification, sintering and other processes to take place in a controlled manner.
|
|
TFT electrical performance is dramatically degraded if a zinc–tin–oxide TFT is covered with a dielectric layer and does not undergo both types of annealing. In addition to silicon dioxide, successful passivation of zinc–tin–oxide TFTs is accomplished using thermally evaporated calcium fluoride, germanium oxide, strontium fluoride, or antimony oxide as passivation.
|
|
The general case is a non-linear model with a partial theoretical structure and some unknown parts derived from data. Models with unlike theoretical structures need to be evaluated individually,Mathworks, 2013. Supported grey box models . possibly using simulated annealing or genetic algorithms. Within a particular model structure, parametersNash, J.C. and Walker-Smith, M. 1987.
|
|
The most familiar example of mean curvature flow is in the evolution of soap films. A similar 2-dimensional phenomenon is oil drops on the surface of water, which evolve into disks (circular boundary). Mean curvature flow was originally proposed as a model for the formation of grain boundaries in the annealing of pure metal.
|
|
Quadratic unconstrained binary optimization (QUBO) is a pattern matching technique, common in machine learning applications. QUBO is an NP hard problem. Examples of problems that can be formulated as QUBO problems are the Maximum cut, Graph coloring and the Partition problem. QUBO problems may sometimes be well-suited to algorithms aided by quantum annealing.
|
|
This conductivity is associated with hydrogen-related species adsorbed at the surface, and it can be removed by annealing or other surface treatments. A 2020 paper reported that extremely thin needles of diamond can be made to vary their electrical resistance from the normal (5.6 eV bandgap) to near zero by selective tensile deformation.
|
|
Graphite is also used in the hot forming of glass. Graphite moulds are prepared by carving into them, machining them into curved forms, or stacking them into shapes. Molten glass is poured into a mould where it is cooled until hard enough to be removed and placed into an annealing kiln to cool slowly.
|
|
In a Bayesian framework, a distribution over the set of allowed models is chosen to minimize the cost. Evolutionary methods, gene expression programming, simulated annealing, expectation-maximization, non-parametric methods and particle swarm optimization are other learning algorithms. Convergent recursion is a learning algorithm for cerebellar model articulation controller (CMAC) neural networks.Ting Qin, et al.
|
|
507x507px At temperatures below 1100 K, zirconium alloys belong to the hexagonal crystal family (HCP). Its microstructure, revealed by chemical attack, shows needle-like grains typical of a Widmanstätten pattern. Upon annealing below the phase transition temperature (α-Zr to β-Zr) the grains are equiaxed with sizes varying from 3 to 5 μm.
|
|
The oxalates are converted to oxides by annealing. The oxides are dissolved in nitric acid that excludes one of the main components, cerium, whose oxide is insoluble in HNO3. The solution is treated with magnesium nitrate to produce a crystallized mixture of double salts of rare- earth metals. The salts are separated by ion exchange.
|
|
Gyrotrons are used for many industrial and high-technology heating applications. For example, gyrotrons are used in nuclear fusion research experiments to heat plasmas and also in manufacturing industry as a rapid heating tool in processing glass, composites, and ceramics, as well as for annealing (solar and semiconductors). Military applications include the Active Denial System.
|
|
The photoresist is stripped. At some point during the subsequent fabrication process, implanted ions are activated by annealing at an elevated temperature. In principle, any number of threshold voltage transistors can be produced. For CMOS having two threshold voltages, one additional photomasking and implantation step is required for each of p-MOSFET and n-MOSFET.
|
|
RTEL1 likely acts by promoting synthesis-dependent strand annealing which results in non-crossover (NCO) recombinants instead of COs (see diagram). Normally, about half of all DSBs are converted into NCOs. RTEL-1 appears to enforce meiotic crossover interference by directing the repair of some DSBs towards NCOs rather than COs. In humans, recombination rate increases with maternal age.
|
|
Dynamic DNA nanotechnology focuses on forming nucleic acid systems with designed dynamic functionalities related to their overall structures, such as computation and mechanical motion. There is some overlap between structural and dynamic DNA nanotechnology, as structures can be formed through annealing and then reconfigured dynamically, or can be made to form dynamically in the first place.
|
|
Laboratory ovens are ovens for high-forced volume thermal convection applications. These ovens generally provide uniform temperatures throughout. Process applications for laboratory ovens can be for annealing, die-bond curing, drying, Polyimide baking, sterilizing, and other industrial laboratory functions. Typical sizes are from one cubic foot to with temperatures that can be over 340 degrees Celsius.
|
|
Thorium precipitates out of solution as hydroxide and is removed. After that the solution is treated with ammonium oxalate to convert rare earths into their insoluble oxalates. The oxalates are converted to oxides by annealing. The oxides are dissolved in nitric acid that excludes one of the main components, cerium, whose oxide is insoluble in HNO3.
|
|
Optionally, a three-layer structure may be used. Where this is the case, the middle layer serves as a diffusion barrier, preventing the metals from mixing during any annealing process. The measurement of contact resistance is most simply performed using a four-point probe although for more accurate determination, use of the transmission line method is typical.
|
|
Eventually two strategies became popular for the self-assembly of 2D architectures, namely self-assembly following ultra-high-vacuum deposition and annealing and self-assembly at the solid-liquid interface. The design of molecules and conditions leading to the formation of highly-crystalline architectures is considered today a form of 2D crystal engineering at the nanoscopic scale.
|
|
The kiln firing programme takes about ten days. During the first 24 hours of the firing programme, more glass is added as the cullet melts down. After 48 hours the glass will have melted and there is nothing to do but wait for the firing cycle to run its course. The cooling or annealing process, takes about a week.
|
|
The scale was divided into 240 equidistant parts. The unheated piece of clay would fit the 0.5-inch gap giving the zero temperature reading. After annealing, the clay cylinder would shrink and fit somewhere in between the left and right ends of the bars, and the temperature could be read from the scales on the bars.
|
|
This requires the precursor concentrations and deposition potential to be optimized. Even with optimization, reproducibility is low over large areas due to composition variations and potential drops along the substrate. The resulting films have small grains, are Cu-rich, and generally contain Cu2−xSex phases along with impurities from the solution. Annealing is required to improve crystallinity.
|
|
The glassmaking operation required three furnaces with different sizes. The first furnace was for melting the glass, the smaller one for annealing or cooling the finished glass. And an even smaller fritting furnace for preheating the ingredients needed for making the glass. A fourth furnace was erected to fire up the clay pots used in the glassmaking process.
|
|
An example of how ERDA can be used by scientists is shown below. In one of the experiments performed by Compsoto, et al., ERDA spectrum was obtained for a thin film of polystyrene (PS) on a deuterated polystyrene (dPS) matrix after annealing for 240 seconds at 171 °C. This spectrum is shown in figure 16 on the left.
|
|
At first the searcher can wander freely, but rising water levels eventually confine the search to a local area. Many other nature-inspired algorithms adopt similar approaches. Simulated annealing achieves a transition between phases via its cooling schedule. The cellular genetic algorithm places solutions in a pseudo landscape in which they breed only with local neighbours.
|
|
The material is kept in a hydrogen annealing oven over several hours at temperatures between 200 °C and 300 °C. The enclosed hydrogen atoms, known for hydrogen embrittlement Effect of temperature on the susceptibility of VT6ch alloy to hydrogen embrittlement are removed by effusion. The method is predominantly used immediately after welding, coating process or galvanizing of the parts.
|
|
The town has a long-standing iron foundry, owned by the ArcelorMittal group. It comprises production lines for rolling, annealing and scouring, and it also manufactures steel. The Arcelor Mittal factory of Saint chely was created in 1916. It produces 100,000 tonnes of steel per year and it is the European leader in top of the range products.
|
|
Ductile materials can sustain large plastic deformations without fracture. However, even ductile metals will fracture when the strain becomes large enough—this is as a result of work hardening of the material, which causes it to become brittle. Heat treatment such as annealing can restore the ductility of a worked piece, so that shaping can continue.
|
|
Crystal structure determination from powder diffraction data is extremely challenging due to the overlap of reflections in a powder experiment. A number of different methods exist for structural determination, such as simulated annealing and charge flipping. The crystal structures of known materials can be refined, i.e. as a function of temperature or pressure, using the Rietveld method.
|
|
Its price was quoted at approximately US$10,000,000. A research team led by Matthias Troyer and Daniel Lidar found that, while there is evidence of quantum annealing in D-Wave One, they saw no speed increase compared to classical computers. They implemented an optimized classical algorithm to solve the same particular problem as the D-Wave One.
|
|
Over time, particles are accelerated towards those particles within their communication grouping which have better fitness values. The main advantage of such an approach over other global minimization strategies such as simulated annealing is that the large number of members that make up the particle swarm make the technique impressively resilient to the problem of local minima.
|
|
TMEJ is often described as alternative NHEJ, but differs in that it lacks a requirement for the Ku heterodimer, and it can only act on resected DNA ends. Following annealing of short (i.e., a few nucleotides) regions on the DNA overhangs, DNA polymerase theta catalyzes template-dependent DNA synthesis across the broken ends, stabilizing the paired structure.
|
|
Thorium precipitates out of solution as hydroxide and is removed. After that, the solution is treated with ammonium oxalate to convert rare earths in to their insoluble oxalates. The oxalates are converted to oxides by annealing. The oxides are dissolved in nitric acid that excludes one of the main components, cerium, whose oxide is insoluble in HNO3.
|
|
FePt NPs are promising materials for ultra-high density magnetic recording media due to their high coercivity. Higher coercivity indicates the material cannot be demagnetized easily. After annealing at 700 °C, the film can have up to 14KOe coercivity compared to common hard drives that have 5KOe coercivity.And nanoparticles have been grown with coercivities up to 37 kOe.
|
|
Metals can be heat- treated to alter the properties of strength, ductility, toughness, hardness and resistance to corrosion. Common heat treatment processes include annealing, precipitation strengthening, quenching, and tempering.Arthur Reardon (2011), Metallurgy for the Non-Metallurgist (2nd edition), ASM International, The annealing process softens the metal by heating it and then allowing it to cool very slowly, which gets rid of stresses in the metal and makes the grain structure large and soft-edged so that when the metal is hit or stressed it dents or perhaps bends, rather than breaking; it is also easier to sand, grind, or cut annealed metal. Quenching is the process of cooling a high-carbon steel very quickly after heating, thus "freezing" the steel's molecules in the very hard martensite form, which makes the metal harder.
|
|
When the Shpolskii effect is manifested, the solid state solubility increases two to three orders of magnitude.L. A. Nakhimovsky, M. Lamotte, J. Joussot-dubien, Handbook of Low Temperature Electronic Spectra of Polycyclic Aromatic Hydrocarbons, Chapter II, Elsevier, 1989 Isothermic annealing of the supersaturated rapidly frozen solutions of dibenzofuran in heptane was performed, and it was shown that the return of the metastable system to equilibrium in time reasonable for laboratory observation required the annealing temperature to be close to the melting temperature of the metastable frozen solution. Thus the Shpolskii systems are an example of a persistent metastable state. A good match between the chromophore and the host lattice leads to a uniform environment for all the chromophores and hence greatly reduces the inhomogeneous broadening of the electronic transition's pure electronic and vibronic lines.
|
|
LIANTI transposome. LIANTI transposome is made by mixing equal molar of Tn5 transposase and LIANTI transposon DNA. The sequence of LIANTI transposon DNA is: 5'/Phos/CTGTCTCTTATACACATCTGAACAGAATTTAATACGACTCACTATAGGGAGATGTGTATAAGAGACAG-3' After self annealing, the LIANTI transposon DNA consists of a 19-bp double- stranded region for Tn5 transposase binding and dimerization, and a 30-nt single-stranded loop containing T7 promoter sequence. 3\. Tn5 transposition.
|
|
Annealing will increase a material's workability and durability, which overall increases open pit mine safety. When groundwater pressures cause problems in open pit mines, horizontal drains are used to aid in accelerating the slope depressurization process. Which helps to prevent large scale slope failure in the mine. Horizontal drains are used to lower pore pressure by reducing groundwater head, which enhances slope stability.
|
|
Deinococcus accomplishes its resistance to radiation by having multiple copies of its genome and rapid DNA repair mechanisms. It usually repairs breaks in its chromosomes within 12–24 hours by a 2-step process. First, D. radiodurans reconnects some chromosome fragments by a process called single-stranded annealing. In the second step, multiple proteins mend double-strand breaks through homologous recombination.
|
|
Poorly prepared junctions to semiconductors can easily show rectifying behaviour by causing depletion of the semiconductor near the junction, rendering the device useless by blocking the flow of charge between those devices and the external circuitry. Ohmic contacts to semiconductors are typically constructed by depositing thin metal films of a carefully chosen composition, possibly followed by annealing to alter the semiconductor–metal bond.
|
|
He is also an Honorary Visiting Professor of economics at the Indian Statistical Institute. Much of Chakrabarti's research has centred around statistical physics & condensed matter physics (including Quantum computing & Quantum annealing; see also D-Wave Systems & Timeline of quantum computing) and their application to social sciences (see e.g., Econophysics). He has authored several books and papers in the fields of physics and economics.
|
|
Another group used a hill climbing procedure that applies network morphisms, followed by short cosine-annealing optimization runs. The approach yielded competitive results, requiring resources on the same order of magnitude as training a single network. E.g., on CIFAR-10, the method designed and trained a network with an error rate below 5% in 12 hours on a single GPU.
|
|
The offer the potential of high integration density, lower power consumption, higher speed and super high frequency. The effects of ion implantation varies according to multiple variables. Collision cascade may occur during implantation and this causes of interstitials and vacancies in target materials (although these defects may be mitigated through dynamic annealing). Collision modes are nuclear collision, electron collision and charge exchange.
|
|
A device for converting the diameter of the annealed clay cylinder into the Wedgwood temperature. A 0.5-inch-diameter cylinder made from pipe clay was dried at the temperature of boiling water. This would prepare it for heating in the oven in which the temperature was to be measured. During the annealing, sintering (merging) of fine particles resulted in contraction of clay.
|
|
M. smegmatis relies on DNA repair pathways to resist DNA damage. Double-strand breaks are especially threatening to bacterial viability. M. smegmatis has three options for repairing double-strand breaks; homologous recombination (HR), non-homologous end joining (NHEJ), and single-strand annealing (SSA). The HR pathway of M. smegmatis is the major determinant of resistance to ionizing radiation and oxidative DNA damage.
|
|
The effect of annealing on the average size and density of graphene islands grown on Pt(111) has been widely studied. Sutter et al., reported a thermal-stress driven wrinkle propagation on the graphene sheet as observed from low-energy electron microscopy during cooling after growth. The onset of lattice mismatch precedes the observation of moiré patterns with small (e.g.
|
|
A counterpunch could be used to create this negative space, not just where the space was completely enclosed by the letter, but in any concavity (e.g., above and below the midbar in uppercase "H"). Of course, the counterpunch had to be harder than the punch itself. This was accomplished by annealing (softening) the punch blank, and hardening and tempering the counterpunch.
|
|
Refractory metals are used in lighting, tools, lubricants, nuclear reaction control rods, as catalysts, and for their chemical or electrical properties. Because of their high melting point, refractory metal components are never fabricated by casting. The process of powder metallurgy is used. Powders of the pure metal are compacted, heated using electric current, and further fabricated by cold working with annealing steps.
|
|
Over extended time periods, thoriated glass may develop significant discoloration. This is due to induced F-centers forming in the glass as the radioactive decay of the thorium progresses. The formation of F-centers is due to the ionizing effect of the high energy thorium decay products. This process can potentially be reversed by annealing the glass or exposing it to light.
|
|
In recent years, non-gradient-based evolutionary methods including genetic algorithms, simulated annealing, and ant colony algorithms came into existence. At present, many researchers are striving to arrive at a consensus regarding the best modes and methods for complex problems like impact damage, dynamic failure, and real-time analyses. For this purpose, researchers often employ multiobjective and multicriteria design methods.
|
|
Matteucci effect is one of the magnetomechanical effects, which is thermodynamically inverse to Wiedemann effect. It is observable in amorphous wires with helical domain structure, which can be obtained by twisting the wire, or annealing under twist. The effect is most distinct in the so-called 'dwarven alloys' (called so because of the historical cobalt element etymology), with cobalt as main substituent.
|
|
Moreover, its magnetostrictive properties can be tuned by inducing a magnetic uniaxial anisotropy. This can be done by magnetic annealing, magnetic field assisted compaction, or reaction under uniaxial pressure. This last solution has the advantage of being ultrafast (20 min) thanks to the use of spark plasma sintering. In early sonar transducers, during World War II, nickel was used as a magnetostrictive material.
|
|
He noticed that the presence of a small quantity of moisture in the rapid thermal annealing chamber is particularly bad for Ohmic contact on AlGaN/GaN HEMT wafers. However, this is less serious for Ohmic contact on GaN only. (Please see references [8].) Dr. Lau has also published a paper on low frequency noise in polysilicon emitter bipolar transistors in 1992.
|
|
These are placed in the annealing oven to cool. The whole structure is enclosed in a wooden building, and it is likely that wood was stored and dried above the furnace. Remains of a similar structure from the late fifteenth century have been found in Eichsfeld in Germany. Another design found archaeologically from the seventeenth century is the 'butterfly furnace'.
|
|
By controlling the evaporation rate of the silicon through this leak, a regulation of the graphene growth rate is possible. Therefore, high-quality graphene layers are obtained in a near- equilibrium environment. The quality of the graphene can also be controlled by annealing in the presence of an external silicon flux. By using disilane gas, the silicon vapor pressure can be controlled.
|
|
Bioglass has to be stored in a dry environment, as it readily absorbs moisture and reacts with it. Bioglass 45S5 is manufactured by conventional glass-making technology, using platinum or platinum alloy crucibles to avoid contamination. Contaminants would interfere with the chemical reactivity in organism. Annealing is a crucial step in forming bulk parts, due to high thermal expansion of the material.
|
|
Many metaheuristic ideas were proposed to improve local search heuristic in order to find better solutions. Such metaheuristics include simulated annealing, tabu search, iterated local search, variable neighborhood search, and GRASP. These metaheuristics can both be classified as local search-based or global search metaheuristics. Other global search metaheuristic that are not local search-based are usually population-based metaheuristics.
|
|
A very active area of research is the design of nature-inspired metaheuristics. Many recent metaheuristics, especially evolutionary computation-based algorithms, are inspired by natural systems. Nature acts as a source of concepts, mechanisms and principles for designing of artificial computing systems to deal with complex computational problems. Such metaheuristics include simulated annealing, evolutionary algorithms, ant colony optimization and particle swarm optimization.
|
|
This is the phenomenon of genetic linkage. The traits that the genes coded for will be coextensive in a population because the gene-types are coextensive in that population. Mendelian assortment and segregation don’t break up these packages of genes with any efficiency. Only crossover, the breaking up and faulty re-annealing of chromosomal strings or similar processes can do this.
|
|
If the reduction in area is greater than 50%, the process may require an intermediate step of annealing before it can be redrawn. Commercial wire drawing usually starts with a coil of hot rolled diameter wire. The surface is first treated to remove scales. It is then fed into a wire drawing machine which may have one or more blocks in series.
|
|
Optimized Markov chain algorithms which use local searching heuristic sub- algorithms can find a route extremely close to the optimal route for 700 to 800 cities. TSP is a touchstone for many general heuristics devised for combinatorial optimization such as genetic algorithms, simulated annealing, tabu search, ant colony optimization, river formation dynamics (see swarm intelligence) and the cross entropy method.
|
|
Some DNA amplification protocols have been developed that may be used alternatively to PCR. They are isothermal, meaning that they are run at a constant temperature. Helicase- dependent amplification (HDA) is similar to traditional PCR, but uses a constant temperature rather than cycling through denaturation and annealing/extension steps. DNA Helicase, an enzyme that unwinds DNA, is used in place of thermal denaturation.
|
|
Coring may be eliminated by a homogenization heat treatment carried out at a temperature below the solidus point for the particular alloy composition. During this process, atomic diffusion occurs, which produces compositionally homogeneous grains. Coring is predominantly observed in alloys having a marked difference between ((liquidus)) and solidus temperatures. It is often being removed by subsequent annealing and/or hot-working.
|
|
Semiconductor doping with boron, phosphorus, or arsenic is a common application of ion implantation. When implanted in a semiconductor, each dopant atom can create a charge carrier in the semiconductor after annealing. A hole can be created for a p-type dopant, and an electron for an n-type dopant. This modifies the conductivity of the semiconductor in its vicinity.
|
|
The polymerase chain reaction is the most widely used method for in vitro DNA amplification for purposes of molecular biology and biomedical research. This process involves the separation of the double-stranded DNA in high heat into single strands (the denaturation step, typically achieved at 95–97 °C), annealing of the primers to the single stranded DNA (the annealing step) and copying the single strands to create new double-stranded DNA (the extension step that requires the DNA polymerase) requires the reaction to be done in a thermal cycler. These bench- top machines are large, expensive and costly to run and maintain, limiting the potential applications of DNA amplification in situations outside the laboratory (e.g., in the identification of potentially hazardous micro- organisms at the scene of investigation, or at the point of care of a patient).
|
|
A clean process oven is a type of industrial batch oven that is ideal for high-temperature applications, such as curing Polyimide, and annealing thin and film waters. Clean process ovens may be for air atmospheres, or inert atmospheres for oxidation-sensitive materials. Temperatures can be over 525 degrees Celsius. Other types of industrial batch ovens include laboratory, burn-in, reach-in, and walk-in/drive-in.
|
|
Upon annealing of pure diamond at ~700 °C, vacancies migrate and form divacancies, characterized by optical absorption and electron paramagnetic resonance. Similar to single interstitials, divacancies do not produce photoluminescence. Divacancies, in turn, anneal out at ~900 °C creating multivacancy chains detected by EPR and presumably hexavacancy rings. The latter should be invisible to most spectroscopies, and indeed, they have not been detected thus far.
|
|
Static deflection is useful for exact positioning of the beam by welding. Dynamic deflection is realized by supplying the deflection coils with currents which can be controlled by the computer. This opens new possibilities for electron- beam applications, like surface hardening or annealing, exact beam positioning, etc. The fast deflection system can also be applied (if provided with appropriate electronics) for imaging and engraving.
|
|
Each Deinococcus radiodurans bacterium contains 4-8 copies of its chromosome. Exposure of D. radiodurans to X-ray irradiation or desiccation can shatter its genomes into hundred of short random fragments. Nevertheless, D. radiodurans is highly resistant to such exposures. The mechanism by which the genome is accurately restored involves RecA-mediated homologous recombination and a process referred to as extended synthesis-dependent strand annealing (SDSA).
|
|
In practice, the constraint can be penalized as part of the objective function. Similar techniques have been independently introduced on several occasions, including Pincus (1970), Khachaturyan et al (1979, 1981), Kirkpatrick, Gelatt and Vecchi (1983), and Cerny (1985). In 1983, this approach was used by Kirkpatrick, Gelatt Jr.,Vecchi, for a solution of the traveling salesman problem. They also proposed its current name, simulated annealing.
|
|
Along with most of Darlington's contracted players, he was given a free transfer at the end of the season. The 1939 Register finds Parkinson working as an annealing furnaceman in a steel foundry and living in Darlington with his wife, Maria Annie née Vest, whom he married in 1936, and their baby son, Walter. He died in Darlington in 1987 at the age of 75.
|
|
MARXAN is a portmanteau acronym, fusing MARine, and SPEXAN, itself an acronym for SPatially EXplicit ANnealing. It was a product of Ian R. Ball's PhD thesis, while he was a student at the University of Adelaide in 2000, and was supervised and funded by Hugh Possingham, who currently holds a Federation Fellowship at the University of Queensland. It was an extension of the existing SPEXAN program.
|
|
The deposited film is non- stoichiometric, and requires annealing to convert to more conductive stoichiometric form. Tungsten silicide is a replacement for earlier tungsten films. Tungsten silicide is also used as a barrier layer between silicon and other metals, e.g. tungsten. Tungsten silicide is also of value towards use in microelectromechanical systems, where it is mostly applied as thin films for fabrication of microscale circuits.
|
|
These peaks are thought to be the result of ssDNA annealing on to itself and creating double stranded random restriction sites which are later recognized by the restriction enzyme resulting in a terminal fragment which does not represent any genuine genetic variant. It has been suggested that applying a DNA exonuclease such as the Mung bean exonuclease prior to the digestion stage might eliminate such artifact.
|
|
The amplification reaction initiates when multiple primer hexamers anneal to the template. When DNA synthesis proceeds to the next starting site, the polymerase displaces the newly produced DNA strand and continues its strand elongation. The strand displacement generates newly synthesized single stranded DNA template for more primers to anneal. Further primer annealing and strand displacement on the newly synthesized template results in a hyper-branched DNA network.
|
|
This is due to base-pair mismatching generated as a result of destabilised heteroduplex annealing between wild-type and variant strands. These differences can be easily seen on the resulting melt curve and the melt profile differences between the different genotypes can be amplified visually via generating a difference curve S Taylor et al., 2010. A Practical Guide To High Resolution Melt Analysis Genotyping.
|
|
This is a copper vase formed using the process of raising. Anticlastic forged sterling bracelet. Raising is a metalworking technique whereby sheet metal is depressed in a stump or other solid object by repeated 'courses' of hammering and annealing. A Sheet metal worker is often required to raise, or bump, the work into form from the flat metal, by means of a raising hammer and raising block.
|
|
A quartz tube furnace is an electric heating device extensively used in material research. For example, ceramic research, wafer sintering and annealing and powder baking and the quartz tube lengths will differ. For experiments in laboratories the size of tube is from 1" to 13", typically controlled by S-type thermocouples. The temperature controllers often allow the operator to program the heating, dwelling and cooling rates.
|
|
Magnesium alloys harden rapidly with any type of cold work, and therefore cannot be extensively cold formed without repeated annealing. Sharp bending, spinning, or drawing must be done at about , although gentle bending around large radii can be done cold. Slow forming gives better results than rapid shaping. Press forging is preferred to hammer forging, because the press allows greater time for metal flow.
|
|
Italian glass blowing techniques such as latticinio and zanfirico are adapted here to make beads. Furnace glass uses large decorated canes built up out of smaller canes, encased in clear glass and then extruded to form the beads with linear and twisting stripe patterns. No air is blown into the glass. These beads require a large scale glass furnace and annealing kiln for manufacture.
|
|
Spinning ratio is defined as depth to diameter ratio and serves as a critical metric for the spinning process. A rating of 100 indicates maximum suitability for the type of spinning indicated, while lower rating values indicate proportionally less ease of forming with spinning methods. It is preferred to use as shallow part as possible, i.e. avoid deep cylindrical designs, which require repeated operations and annealing.
|
|
A team of researchers based at the Technical University of Dresden that used x-rays and electron microscopy to examine Damascus steel discovered the presence of cementite nanowires and carbon nanotubes. Peter Paufler, a member of the Dresden team, says that these nanostructures are a result of the forging process. Sanderson proposes that the process of forging and annealing accounts for the nano-scale structures.
|
|
Crystal structure prediction (CSP) is the calculation of the crystal structures of solids from first principles. Reliable methods of predicting the crystal structure of a compound, based only on its composition, has been a goal of the physical sciences since the 1950s. Computational methods employed include simulated annealing, evolutionary algorithms, distributed multipole analysis, random sampling, basin-hopping, data mining, density functional theory and molecular mechanics.
|
|
Gaussian caustic means that each micro-surface obey gaussian distribution. The position and orientation of each of the micro-surfaces is then obtained using a combination of Poisson integration and simulated annealing. There have been many different approaches to address the continuous problem. One approach uses an idea from transportation theory called optimal transport to find a mapping between incoming light rays and the target surface.
|
|
On May 11, 2011, D-Wave Systems announced the D-Wave One, an integrated quantum computer system running on a 128-qubit processor. The processor used in the D-Wave One, code-named "Rainier," performs a single mathematical operation, discrete optimization. Rainier uses quantum annealing to solve optimization problems. The D-Wave One was claimed to be the world's first commercially available quantum computer system.
|
|
A solution is to give up on finding the absolute best solution and attempt to find a good solution instead. By creating random solutions, using those as a starting point and improving upon them, one can find a solution that is a fair approximation of the "best" solution. One construction method used to get around this problem is the Iterative Improvement algorithm. Another is Simulated Annealing.
|
|
These look like human HMG-box proteins, because of their influence on genomes, for the expression and the stability, and on epigenetic processes. In species lacking histones they can be acetylated and methylated like eukaryotic histones. Sulfolobus strains present different peculiar DNA binding proteins, such as the Sso7d protein family. They stabilize the double helix, preventing denaturation at high temperature thus promoting annealing above the melting point.
|
|
McGeoch graduated summa cum laude from Butler University in 1981. She then earned her M.S. (1983) and her Ph.D.(1986) from Carnegie Mellon University, supervised by Jon Bentley. She is the author of A Guide to Experimental Algorithmics () and Adiabatic Quantum Computation and Quantum Annealing: Theory and Practice (). In 2013, she published one of the first detailed benchmarks of D-Wave's Quantum Computer versus conventional software.
|
|
Adams performed one of his first research projects during World War I, when he produced optical glass. He helped to develop a new method for annealing glass which was effective for large blocks, and then used this technique to make a 200-inch mirror for the Hale telescope at the Mount Palomar Observatory. For this work, he received the Edward Longstreth Medal of the Franklin Institute.
|
|
Repair of the gap can lead to crossover (CO) or non-crossover (NCO) of the flanking regions. CO recombination is thought to occur by the Double Holliday Junction (DHJ) model, illustrated on the right, above. NCO recombinants are thought to occur primarily by the Synthesis Dependent Strand Annealing (SDSA) model, illustrated on the left, above. Most recombination events appear to be the SDSA type.
|
|
The dry process involves extruding, annealing and stretching steps. The final porosity depends on the morphology of the precursor film and the specifics of each step. The extruding step is generally carried out at a temperature higher than the melting point of the polymer resin. This is because the resins are melted to shape them into a uniaxially-oriented tubular film, called a precursor film.
|
|
All metals have a property called hardness, which is the property of the metal that resists bending. Soft metals are pliable and easy to bend while hard metals are stiff and hard to bend. The hardness of metals can be changed by annealing with heat treatment, or by work hardening a wire by bending it. Since it is made of metal, wire has this same hardness property.
|
|
At the Alaska–Yukon–Pacific Exposition in Seattle, in 1909, the Monarch was awarded the gold medal. Prior to 1910, the malleable iron castings needed for their products were purchased from other companies until they could build their own foundry. Additions to the manufacturing building and annealing building were also built in 1910. In 1912 a warehouse was constructed that was later used as a machine shop.
|
|
CBRAM cells generally would not require forming if Cu ions are already present in the electrolyte, having already been driven-in by a designed photo-diffusion or annealing process; such cells may also readily return to their initial state. In the absence of such Cu initially being in the electrolyte, the voltage would still be applied directly to the electrolyte, and forming would be a strong possibility.
|
|
After a brief period with Radnički Obrenovac, he moved to OFK Beograd, where he spent next 10 years. He was also loaned to Red Star Belgrade as a youngster. After returning to OFK Beograd, he signed a contract and joined the first team. However, he did not to receive a lot of confidence, after annealing at Palilulac and Sopot, he returned to Radnički Obrenovac.
|
|
In the processing of glass-ceramics, molten glass is cooled down gradually before reheating and annealing. In this heat treatment the glass partly crystallizes. In many cases, so-called 'nucleation agents' are added in order to regulate and control the crystallization process. Because there is usually no pressing and sintering, glass-ceramics do not contain the volume fraction of porosity typically present in sintered ceramics.
|
|
As such, the complex cleaves the links between two homologous chromosomes that form during homologous recombination. This allows the two linked chromosomes to resolve into two unconnected double-strand DNA molecules. The SLX4 interacting protein interacts with SLX4 in the DNA repair process, specifically in interstrand crosslink repair. SLX4 also associates with RAD1, RAD10 and SAW1 in the single-strand annealing pathway of homologous recombination.
|
|
Ultra low expansion glass has an coefficient of thermal expansion of about 10−8/K at 5–35 °C. It has a thermal conductivity of 1.31 w/(m • °C), thermal diffusion of 0.0079 cm2/s, a mean specific heat of 767 J/ (kg • °C), a strain point of 890 °C [1634 °F], and an estimated softening point of 1490 °C [2714 °F], an annealing point of 1000 °C [1832 °F].
|
|
The hot strip mill's closure in 1992, however, eliminated 930 jobs. The Sinter plant, cold strip mill, temper mills, pickling lines, annealing lines and machine shop all closed by 1995. In May 1989, Armco sold 40 percent of its company to Kawasaki Steel of Japan; the remainder was sold in 1994 and the plant was renamed for AK Steel. By becoming more efficient, the plant saw increasing profits.
|
|
Rigid copper is a popular choice for water lines. It is joined using a sweat, compression or crimped/pressed connection. Rigid copper, rigid due to the work hardening of the drawing process, cannot be bent and must use elbow fittings to go around corners or around obstacles. If heated and allowed to slowly cool, called annealing, then rigid copper will become soft and can be bent/formed without cracking.
|
|
Flexible solar cells have been a topic of interest for less conspicuous-integrated power generation than solar power farms. These modules may be placed in areas where traditional cells would not be feasible, such as wrapped around a telephone pole or cell phone tower. In this application a photovoltaic material may be applied to a flexible substrate, often a polymer. Such substrates cannot survive the high temperatures experienced during traditional annealing.
|
|
CO recombination is thought to occur by the Double Holliday Junction (DHJ) model, illustrated on the right, above. NCO recombinants are thought to occur primarily by the Synthesis Dependent Strand Annealing (SDSA) model, illustrated on the left, above. Most recombination events appear to be the SDSA type. Meiotic crossovers (COs) appear to be regulated to ensure that COs on the same chromosome are distributed far apart (crossover interference).
|
|
The presence of carbon has a more detrimental effect than sulfur or oxygen. Carbon also causes magnetic aging when it slowly leaves the solid solution and precipitates as carbides, thus resulting in an increase in power loss over time. For these reasons, the carbon level is kept to 0.005% or lower. The carbon level can be reduced by annealing the alloy in a decarburizing atmosphere, such as hydrogen.
|
|
To elucidate the structure of the cone walls, electron diffraction patterns were recorded at different cone orientations. Their analysis suggests that the walls contain 10–30% of ordered material covered with amorphous carbon. High-resolution electron microscopy reveals that the ordered phase consists of nearly parallel layers of graphene. The amorphous fraction can be converted into well-ordered graphite by annealing the cones at temperatures about 2700 °C.
|
|
If performed in vacuum, it is common to reach 96–99% solid density. The end-product metal has comparable mechanical and physical properties with annealed parts made using classic metalworking methods. Post sintering heat treatments for MIM are the same as with other fabrication routes, and with high density the MIM component is compatible with the metal conditioning treatments such as plating, passivating, annealing, carburizing, nitriding, and precipitation hardening.
|
|
This lends credence to the hypothesis that red diamonds are in fact extremely dark pink diamonds, and why only one color intensity is possible. It is possible for red diamonds to be modified by the same secondary colors that can be found modifying pink diamonds as well. Red color can be produced by irradiating a colorless diamond by high-energy particles and then annealing it at high pressures and high temperatures.
|
|
Generally speaking, the Monte Carlo method is a statistical approach to solve deterministic many-body problems. In 1953 Metropolis co-authored the first paper on a technique that was central to the method now known as simulated annealing. This landmark paper showed the first numerical simulations of a liquid. The algorithm for generating samples from the Boltzmann distribution was later generalized by W.K. Hastings to become the Metropolis-Hastings algorithm.
|
|
Verhoeven, J.D. Fundamentals of Physical Metallurgy, Wiley, New York, 1975, p. 326 The second stage is recrystallization, where new strain-free grains nucleate and grow to replace those deformed by internal stresses. If annealing is allowed to continue once recrystallization has completed, then grain growth (the third stage) occurs. In grain growth, the microstructure starts to coarsen and may cause the metal to lose a substantial part of its original strength.
|
|
The main sources for Bulgarian domestic use-oriented pottery are the necropoleis at Novi Pazar, Devnya, and Varna. The vessels were made with a potter's wheel, unlike Slavic practice. Since the 9th century two-story ovens were used for the annealing of the pottery. The shape and decoration of early Bulgarian pottery was similar to that found in northern Caucasus, the Crimea, and the shores of the Sea of Azov.
|
|
Approaches for shuffling the numbers include simulated annealing, genetic algorithm and tabu search. Stochastic-based algorithms are known to be fast, though perhaps not as fast as deductive techniques. Unlike the latter however, optimisation algorithms do not necessarily require problems to be logic-solvable, giving them the potential to solve a wider range of problems. Algorithms designed for graph colouring are also known to perform well with Sudokus.
|
|
When designing primers for polymerase chain reaction, inosine is useful in that it can pair with any natural base. This allows for design of primers that span a single-nucleotide polymorphism, without the polymorphism disrupting the primer's annealing efficiency. However, inosine pairs preferentially with cytosine (C) and its introduction to RNA, e.g. by the action of ADARs, thereby destabilizes double-stranded RNA by changing AU base-pairs to IU mismatches.
|
|
If there is not enough ambient carbon in the furnace, the steel will give up some of its carbon and will become soft. The result is a thin surface of inadequate metal whose chemical composition has been altered and is below standard. Another less obvious error can also occur when heating the dies. After being taken out of the annealing furnace, the dies must cool for 24 to 36 hours.
|
|
Repeated recombination also has the general effect of allowing genes to move independently of each other through the generations, allowing for the independent concentration of beneficial genes and the purging of the detrimental. Following synapsis, a type of recombination referred to as synthesis dependent strand annealing (SDSA) occurs frequently. SDSA recombination involves information exchange between paired non-sister homologous chromatids, but not physical exchange. SDSA recombination does not cause crossing-over.
|
|
Although this degradation is perfectly reversible upon annealing at or above 150 °C, conventional c-Si solar cells do not exhibit this effect in the first place. Its basic electronic structure is the p-i-n junction. The amorphous structure of a-Si implies high inherent disorder and dangling bonds, making it a bad conductor for charge carriers. These dangling bonds act as recombination centers that severely reduce carrier lifetime.
|
|
Using ITO nanoparticles imposes a limit on the choice of substrate, owing to the high temperature required for sintering. As an alternative starting material, In-Sn alloy nanoparticles allow for a more diverse range of possible substrates. A continuous conductive In-Sn alloy film is formed firstly, followed by oxidation to bring transparency. This two step process involves thermal annealing, which requires special atmosphere control and increased processing time.
|
|
Molten salts have a variety of uses. Molten chloride salt mixtures are commonly used as baths for various alloy heat treatments, such as annealing and martempering of steel. Cyanide and chloride salt mixtures are used for surface modification of alloys such as carburizing and nitrocarburizing of steel. Cryolite (a fluoride salt) is used as a solvent for aluminium oxide in the production of aluminium in the Hall-Héroult process.
|
|
Fritting, and the preheating of crucibles may have occurred in the upper areas of the main furnace. Annealing (glass) and glass blowing probably occurred using a smaller furnace. Cullet heaps of broken glass residue were found on either side, suggesting the use of a flux to reduce melting temperatures. Some crushed white pebbles were recovered in the bottom of pots, and this may reflect the silica source used at this site.
|
|
For a doubly doped lithium niobate (LiNbO3) crystal there exists an optimum oxidation/reduction state for desired performance. This optimum depends on the doping levels of shallow and deep traps as well as the annealing conditions for the crystal samples. This optimum state generally occurs when 95–98% of the deep traps are filled. In a strongly oxidized sample holograms cannot be easily recorded and the diffraction efficiency is very low.
|
|
AMAP is a multiple sequence alignment program based on sequence annealing. This approach consists of building up the multiple alignment one match at a time, thereby circumventing many of the problems of progressive alignment. The AMAP parameters can be used to tune the sensivitiy-specificity tradeoff. The program can be used through the AMAP web server or as a standalone program which can be installed with the source code.
|
|
Quantum annealing or Adiabatic quantum computation relies on the adiabatic theorem to undertake calculations. A system is placed in the ground state for a simple Hamiltonian, which is slowly evolved to a more complicated Hamiltonian whose ground state represents the solution to the problem in question. The adiabatic theorem states that if the evolution is slow enough the system will stay in its ground state at all times through the process.
|
|
Daisy chaining DNA is when DNA undergoing PCR amplification forms tangles that resemble a 'daisy chain.' During PCR, primers or dNTP's will eventually be used up and limit further reactions. The depletion of primers causes daisy chaining; since the denaturing and annealing processes will still continue without primers, the single-stranded DNA molecules will reanneal to themselves. However, this reannealing does not always occur with another complementary strand.
|
|
The protein encoded by this gene shares similarity with Saccharomyces cerevisiae Rad52, a protein important for DNA double-strand break repair and homologous recombination. This gene product was shown to bind single-stranded DNA ends, and mediate the DNA-DNA interaction necessary for the annealing of complementary DNA strands. It was also found to interact with DNA recombination protein RAD51, which suggested its role in RAD51-related DNA recombination and repair.
|
|
In addition, human RAD52, in combination with ERCC1, promotes the error-prone homologous DNA repair pathway of single-strand annealing. Though error prone, this repair pathway may be needed for survival of cells with DNA damage that is not otherwise repairable. Human RAD52 also has an important role in repair of DNA double-strand breaks at active transcription sites during the G0/G1 phase of the cell cycle.
|
|
Ekanite is almost invariably found completely metamict as thorium and uranium are part of its essential chemical composition. Metamict minerals can have their crystallinity and properties restored through prolonged annealing. A related phenomenon is the formation of pleochroic halos surrounding minute zircon inclusions within a crystal of biotite or other mineral. The spherical halos are produced by alpha particle radiation from the included uranium- or thorium-bearing species.
|
|
The structure and orientation of the precursor film depends on the processing conditions and the resin's characteristics. In the annealing process, the precursor is annealed at a temperature slightly lower than the polymer's melting point. The purpose of this step is to improve the crystalline structure. During stretching, the annealed film is deformed along the machine direction by a cold stretch followed by a hot stretch followed by relaxation.
|
|
The glassworks of Trinquetaille is made up of an initial hall, augmented by a building built between 1782 and 1785. The buildings are built of stone (stone of Beaucaire) and stone coated with lime. Building A is present before the large hall (building E) built in 1783 on a basilical plane sheltering two corridors of air circulation perpendicular around a central melting furnace. There were several annealing furnaces and crucibles.
|
|
Primers are designed to be extended _outward_ from the known segment, resulting in amplification of the rest of the circle. This is especially useful in identifying sequences to either side of various genomic inserts. Similarly, thermal asymmetric interlaced PCR (or TAIL-PCR) is used to isolate unknown sequences flanking a known area of the genome. Within the known sequence, TAIL-PCR uses a nested pair of primers with differing annealing temperatures.
|
|
Iron and Steel International, Vol.40, p.28 This allowed many buildings to be put to new uses: the south-east crucible shops as stores, the heat treatment workshop as a stock grinding plant, and the steel working shop as an annealing and cleaning plant. The gas- fired crucible furnaces and the gas plant were demolished, but English Heritage believe that substantial remains of these exist below ground.
|
|
Single-walled nanotubes (SWNTs) were first seen in 1993 as cylinders rolled from a single graphene sheet. In 1998, the first peapod was observed by Brian Smith, Marc Monthioux and David Luzzi. The idea of peapods came from the structure that was produced inside a transmission electron microscope in 2000. They were first recognized in fragments obtained by a pulsed-laser vaporization synthesis followed by treatment with an acid and annealing.
|
|
After weeks of troubleshooting of an identical flight spare of the recorder on the ground, it was determined that the cause of the malfunction was a reduction of light output in three infrared Optek OP133 light-emitting diodes located in the drive electronics of the recorder's motor encoder wheel. The GaAs LEDs had been particularly sensitive to proton-irradiation-induced atomic lattice displacement defects, which greatly decreased their effective light output and caused the drive motor's electronics to falsely believe the motor encoder wheel was incorrectly positioned. Galileo flight team then began a series of "annealing" sessions, where current was passed through the LEDs for hours at a time to heat them to a point where some of the crystalline lattice defects would be shifted back into place, thus increasing the LED's light output. After about 100 hours of annealing and playback cycles, the recorder was able to operate for up to an hour at a time.
|
|
Fluorescent properties in nanodiamonds arise from the presence of nitrogen vacancy (NV) centers, nitrogen atom next to a vacancy. Fluorescent nanodiamond (FND) was invented in 2005 and has since been used in various fields of study. The invention received an US patent in 2008 , and a subsequent patent in 2012 . NV centres can be created by irradiating nanodiamond with high-energy particles (electrons, protons, helium ions), followed by vacuum-annealing at 600–800 °C.
|
|
Electron micrograph showing several octahedral voidites Voidites are octahedral nanometer-sized clusters present in many natural diamonds, as revealed by electron microscopy. Laboratory experiments demonstrated that annealing of type-IaB diamond at high temperatures and pressures (>2600 °C) results in break-up of the platelets and formation of dislocation loops and voidites, i.e. that voidites are a result of thermal degradation of platelets. Contrary to platelets, voidites do contain much nitrogen, in the molecular form.
|
|
Optimal packing fraction for hard spheres of diameter d inside a cylinder of diameter D. Columnar structures arise naturally in the context of dense hard sphere packings inside a cylinder. Mughal et al. studied such packings using simulated annealing up to the diameter ratio of D/d = 2.873 for cylinder diameter D to sphere diameter d. This includes some structures with internal spheres that are not in contact with the cylinder wall.
|
|
In 2012, Vaughey, et al., reported a new all-inorganic electrode structure based on electrochemically active silicon particles bound to a copper substrate by a Cu3Si intermetallic. Copper nanoparticles were deposited on silicon particles articles, dried, and laminated onto a copper foil. After annealing, the copper nanoparticles annealed to each other and to the copper current collector to produce a porous electrode with a copper binder once the initial polymeric binder burned out.
|
|
Afterward, the fuel balls were sampled and examined for damage - there was none. PBRs are intentionally operated above the 250 °C annealing temperature of graphite, so that Wigner energy is not accumulated. This solves a problem discovered in an infamous accident, the Windscale fire. One of the reactors at the Windscale site in England (not a PBR) caught fire because of the release of energy stored as crystalline dislocations (Wigner energy) in the graphite.
|
|
NCO recombinants are thought to occur primarily by the Synthesis Dependent Strand Annealing (SDSA) model, illustrated on the left, above. Most recombination events appear to be the SDSA type. MCM8 forms a complex with MCM9 that is required for DNA resection by the MRN complex (MRE11-RAD50-NBS1) at double strand breaks to generate single-stranded DNA ends. The formation of single-strand ends is an early step in homologous recombination (see Figure).
|
|
Metal hydride for hydrogen storage applications Interstitial hydrides most commonly exist within metals or alloys. They are traditionally termed "compounds" even though they do not strictly conform to the definition of a compound, more closely resembling common alloys such as steel. In such hydrides, hydrogen can exist as either atomic or diatomic entities. Mechanical or thermal processing, such as bending, striking, or annealing, may cause the hydrogen to precipitate out of solution by degassing.
|
|
The steel industry is one of the largest users of rotary unions primarily for continuous casting machines (CCM) which use rotary unions to cool the numerous rolls that support molten slabs as it moves by gravity through various segments onto a run-out table to downstream annealing and heat treating. The slab is formed into coil or sheet. Coil is further converted in processing centers that require hydraulic unions for actuation of mandrels.
|
|
His three-step process aimed at producing heat-resistant blocks from such oxide materials as zirconia, thoria or tantalia. The steps were: (i) molding the powder; (ii) annealing it at about 2500 °C to make it conducting; (iii) applying current-pressure sintering as in the method by Weintraub and Rush. Sintering that uses an arc produced via a capacitance discharge to eliminate oxides before direct current heating, was patented by G. F. Taylor in 1932.
|
|
Wannomae, K. K., Micheli, B. R.; Lozynsky, A. J. and Muratoglu, O. K. (2010) "A new method of stabilising irradiated UHMWPE using Vitamin E and mechanical annealing". 56th Annual Meeting of the Orthopedic Research Society, 2290. Several companies have been selling antioxidant- stabilized joint replacement technologies since 2007, using both synthetic vitamin E as well as hindered phenol-based antioxidants.Spiegelberg, S.H. (2012) "UHMWPE for total joint arthroplasty: Past, present, and future". Bonezone.
|
|
Possibly the least known, but vitally important, industry in Ancoats was the manufacture of flint glass. More than 25 glassworks have been identified in Manchester, all built during the 19th century, and many of these were in Ancoats. Thomas Percival and William Yates established one of these on Union Street (now Redhill Street) in 1844. The works was equipped with two furnaces (later three), an annealing house, workshops, a warehouse and offices.
|
|
This is one of the difficult tasks for traditional computing techniques, and has been efficiently solved by the use of fuzzy logic (which is a lateral computing technique). Lateral-computing sometimes arrives at a novel solution for particular computing problem by using the model of how living beings, such as how humans, ants, and honeybees, solve a problem; how pure crystals are formed by annealing, or evolution of living beings or quantum mechanics etc.
|
|
In 1954, McLouth announced the construction of a cold rolling facility in Gibraltar, Michigan, close to the Trenton Plant. This facility has a four stand continuous cold rolling strip mill, annealing furnaces, two skin pass finishing mills and other ancillary equipment for further processing of cold rolled steel coils. The property the company acquired was once owned by the Gibraltar Steel Corporation. The total area was around of land along the river bordering Trenton.
|
|
After annealing, it has a tensile strength of about 40 kg/mm2. The most valuable property of melchior is its high resistance to corrosion in air, freshwater and seawater. Increasing content of nickel iron or manganese improves corrosion and cavitation resistance, especially in sea water and atmospheric water vapor. The alloy of 30% Ni, 0.8% Fe, 1% Mn and 68.2% copper is used in maritime shipping, in particular for the manufacture of condenser tubes.
|
|
The annealing temperature has a dramatic influence on the rate of recrystallization which is reflected in the above equations. However, for a given temperature there are several additional factors that will influence the rate. The rate of recrystallization is heavily influenced by the amount of deformation and, to a lesser extent, the manner in which it is applied. Heavily deformed materials will recrystallize more rapidly than those deformed to a lesser extent.
|
|
This included new constructions of: an effluent plant; single stack annealing line; two electrolytic tinning lines (ETL); a cleaning line; and a Hallden Shears plant. Having cost £57 million, the plant was officially opened in June 1978 by Derek Hornby, the President of the Food Manufacturing Federation. It was envisaged in the original plan that phase3 would then be constructed to double production yet again, but it was never authorised for planning by the government.
|
|
CH4, Xe, Kr) are cubic and the symmetry lowers to tetragonal for non-spherical guests like tetrahydrofuran or tetrahydrothiophene. Since many molecules form unstable guests, the symmetry of melanophlogite can change between cubic and tetragonal upon mild heating (<100 °C). Even the cubic melanophlogite often shows anisotropic optical properties. They were attributed not to tetragonal fragments but to the organic film in the mineral which could be removed by low-temperature annealing (~400 °C).
|
|
Annealing occurs by the diffusion of atoms within a solid material, so that the material progresses towards its equilibrium state. Heat increases the rate of diffusion by providing the energy needed to break bonds. The movement of atoms has the effect of redistributing and eradicating the dislocations in metals and (to a lesser extent) in ceramics. This alteration to existing dislocations allows a metal object to deform more easily, increasing its ductility.
|
|
Resistive heating can be used to efficiently anneal copper wire; the heating system employs a controlled electrical short circuit. It can be advantageous because it does not require a temperature-regulated furnace like other methods of annealing. The process consists of two conductive pulleys (step pulleys), which the wire passes across after it is drawn. The two pulleys have an electrical potential across them, which causes the wire to form a short circuit.
|
|
Before work hardening, the lattice of the material exhibits a regular, nearly defect-free pattern (almost no dislocations). The defect-free lattice can be created or restored at any time by annealing. As the material is work hardened it becomes increasingly saturated with new dislocations, and more dislocations are prevented from nucleating (a resistance to dislocation- formation develops). This resistance to dislocation-formation manifests itself as a resistance to plastic deformation; hence, the observed strengthening.
|
|
If work continues beyond a certain hardness the metal will tend to fracture when worked and so it may be re- annealed periodically as shaping continues. Annealing is stopped when the workpiece is near its final desired shape, and so the final product will have a desired stiffness and hardness. The technique of repoussé exploits these properties of copper, enabling the construction of durable jewelry articles and sculptures (such as the Statue of Liberty).
|
|
Hard and soft matter interests continued after joining the faculty at UPenn (1983), the staff at Exxon Research (1983) and the faculty at Princeton University (1988). His interests in geometry/topology led to his founding contributions to diblock copolymer nanolithography, and studies of defects, annealing, and pattern formation. He helped demonstrate and explain why ellipsoids pack more densely than spheres. In 2005 he helped found the Center for Soft Matter Research at New York University.
|
|
1QBit has divisions focused on universal quantum computing, advanced AI techniques, cloud based quantum processing, and hardware innovation. 1QBit's 1Qloud platform is focused on optimization including reformulating optimization problems into the quadratic unconstrained binary optimization (QUBO) format necessary to compute with quantum annealing processors and similar devices from organizations such as Fujitsu, D-Wave, Hitachi and NTT, while their QEMIST platform is focused on advanced materials and quantum chemistry research with universal quantum computing processors.
|
|
Annealing is a crucial step in forming bulk parts, due to high thermal expansion of the material. Heat treatment of Bioglass reduces the volatile alkali metal oxide content and precipitates apatite crystals in the glass matrix. However, the scaffolds that result from melt quench techniques are much less porous compared to other manufacturing methods, which may lead to defects in tissue integration when implanted in vivo. The second method is sol-gel synthesis of Bioglass.
|
|
Little labor is required to operate the machinery. There is no flash produced so material savings are between 20 - 30% over conventional forging. The final product is a consistent 1050 °C (1900 °F) so air cooling will result in a part that is still easily machinable (the advantage being the lack of annealing required after forging). Tolerances are usually ±0.3 mm (±0.012 in.), surfaces are clean, and draft angles are 0.5 to 1°.
|
|
Care must be taken to sinter YBCO. YBCO is a crystalline material, and the best superconductive properties are obtained when crystal grain boundaries are aligned by careful control of annealing and quenching temperature rates. Numerous other methods to synthesize YBCO have developed since its discovery by Wu and his co-workers, such as chemical vapor deposition (CVD), sol-gel, and aerosol methods. These alternative methods, however, still require careful sintering to produce a quality product.
|
|
This process could be repeated to create more small cracks. The copper could then be cold- hammered into shape, which would make it brittle, or hammered and heated in an annealing process to avoid this. The final object would then have to be ground and sharpened using local sandstone. Numerous bars have also been found, possibly indicative of trade for which their shaping into a bar would also serve as proof of quality.
|
|
They often have bluish color owing to the presence of colloidal Li. This color can be removed by post-growth annealing at lower temperatures (~550 °C) and lower thermal gradients. Major impurities in these crystals are Na (20–200 parts per million, ppm), O (10–100 ppm), Mg (0.5–6 ppm), Fe (0.5-2 ppm) and Cu (0.5-2 ppm). Cracking in cast LiH after machining with a fly cutter. Scale is in inches.
|
|
Ceramic binders can be used as well. Commercial products are known under names "Borazon" (by Diamond Innovations), and "Elbor" or "Cubonite" (by Russian vendors). Contrary to diamond, large c-BN pellets can be produced in a simple process (called sintering) of annealing c-BN powders in nitrogen flow at temperatures slightly below the BN decomposition temperature. This ability of c-BN and h-BN powders to fuse allows cheap production of large BN parts.
|
|
This is necessary to hard-cure the BCB. The vacuum prevents air trapped in the bond interface and pumps out the gases of the out-gassing residual solvents during annealing. The temperature and the curing time are variable, so with a higher temperature curing time can be reduced based on a quicker cross-linking. The final bonding layer thickness depends on the thickness of the cured BCB, the spinning speed and the shrink rate.
|
|
Using this technique, the resulting graphene consists of small grains with varying thickness (30 nm-200 nm). These grains occur due to morphological changes of the SiC surface under high temperatures. On the other side, at relatively low temperatures, poor quality occurs due to the high sublimation rate. The growth procedure was improved to a more controllable technique by annealing the SiC-samples at high temperatures over 1650 °C in an argon environment.
|
|
This repair process can follow either of two alternative pathways as illustrated in the Figure. By one pathway, a structure called a double Holliday junction (DHJ) is formed, leading to the exchange of DNA strands. By the other pathway, referred to as Synthesis Dependent Strand Annealing (SDSA), there is information exchange but not physical exchange. Gene conversion will occur during SDSA if the two DNA molecules are heterozygous at the site of the recombinational repair.
|
|
She has used self-assembly to encourage the fabrication of large area opals without cracks. These cracks appear during annealing, and can be eliminated using a bi-capillary growth mechanism to encourage growth separately from solvent evaporation. The photonic crystals developed by Dawes can include rare earth ion optical emitters and nanodiamonds that include colour centres. In general, Dawes creates the opals using self-assembly, starting with a suspension of polystyrene or microsphere of silica.
|
|
Plasma-activated bonding is a derivative, directed to lower processing temperatures for direct bonding with hydrophilic surfaces. The main requirements for lowering temperatures of direct bonding are the use of materials melting at low temperatures and with different coefficients of thermal expansion (CTE). Surface activation prior to bonding has the typical advantage that no intermediate layer is needed and sufficiently high bonding energy is achieved after annealing at temperatures below 400 °C.
|
|
This is followed by recruitment of XRCC1–LIG3 to the site for ligating the DNA ends, leading to an intact DNA. MMEJ is always accompanied by a deletion, so that MMEJ is a mutagenic pathway for DNA repair. The extremophile Deinococcus radiodurans has a remarkable ability to survive DNA damage from ionizing radiation and other sources. At least two copies of the genome, with random DNA breaks, can form DNA fragments through annealing.
|
|
After strand invasion, the further sequence of events may follow either of two main pathways leading to a crossover (CO) or a non-crossover (NCO) recombinant (see Genetic recombination and see Figure). The pathway leading to a NCO is referred to as Synthesis-dependent strand annealing (SDSA). In the plant Arabidopsis thaliana, multiple mechanisms limit meiotic COs. During meiosis TOP3A and RECQ4A/B helicase antagonize formation of COs in parallel to FANCM helicase.
|
|
Boron trioxide (or diboron trioxide) is one of the oxides of boron. It is a white, glassy solid with the formula B2O3. It is almost always found as the vitreous (amorphous) form; however, it can be crystallized after extensive annealing (that is, under prolonged heat). Glassy boron oxide (g-B2O3) is thought to be composed of boroxol rings which are six-membered rings composed of alternating 3-coordinate boron and 2-coordinate oxygen.
|
|
Shorter oligos have lower hybridization energies, resulting in decreased stability of the oligo to the chromosomal target. Of this sequence, at least 15 base pairs should be homologous to the target sequence at both the 5’ and 3’ ends to provide sufficient oligo annealing. Another consideration is the inclusion of phosphorothioate bonds. In a phosphorothioate bond, one of the non-bridging oxygens between nucleotide bases is replaced with a sulfur atom, changing the chemical properties.
|
|
W. Chism et al., "Photoreflectance characterization of ultrashallow junction activation in millisecond annealing," J. Vac. Sci. Technol. B 28, C1C15-C1C20 (2010). doi:10.1116/1.3253327 This probe beam wavelength also provided excellent sensitivity to strain in strained silicon processes.W. Chism et al., "Photo-Reflectance Characterization of Nanometer Scale active Layers in Si," in AIP Conference Proceedings, Vol. 931 ("Frontiers of Characterization and Metrology for Nanoelectronics: 2007"), edited by D.G. Seiler et al., pp.
|
|
Individual DNDs before and after annealing at 520 °C Electron micrograph of aggregated DNDs Trinitrotoluene (TNT) structure Hexogen (RDX) structure Detonation nanodiamond (DND), also known as ultradispersed diamond (UDD), is diamond that originates from a detonation. When an oxygen-deficient explosive mixture of TNT/RDX is detonated in a closed chamber, diamond particles with a diameter of c. 5 nm are formed at the front of the detonation wave in the span of several microseconds.
|
|
Once these five key parts are combined they can be put into a PCR thermocycler. In this device the mixture is exposed to a series of temperatures over and over again cycling between 94-95°C, 50-56°C, and 72°C. These three stages are known as the denaturing, annealing and extending stages. During the denaturing stage at 94-95°C the DNA chains separate allowing for new bonds to be made.
|
|
In particular, by vacuum annealing silicon carbide single crystals (wafers) at 1200–1500 °C, metal/metalloid atoms are selectively removed and a layer of 1–3 layer graphene (depending on the treatment time) is formed, undergoing a conformal transformation of 3 layers of silicon carbide into one monolayer of graphene. Also, graphene formation occurs preferentially on the Si-face of the 6H-SiC crystals, while nanotube growth is favored on the c-face of SiC.
|
|
It is sometimes used as a reducing agent for high-temperature soldering and brazing, to remove oxidation of the joint without the use of flux. It also finds application in microchip production, where a high-temperature anneal in forming gas assists in silicon- silicon dioxide interface passivation. Quite often forming gas is used in furnaces during annealing or sintering for the thermal treatment of metals, because it reduces oxides on the metal surface.
|
|
Another approach is to immerse the case mouth in a molten alloy of lead that is at the desired annealing temperature for a few seconds, then quickly shake off the lead and quench the case. Cases that have small cracks at the neck may not be a complete loss. Many cartridges, both commercial and wildcats, can be made by shortening a longer cartridge. For example, a 223 Remington can be shortened to become a .
|
|
Pure diamonds, before and after irradiation and annealing. Clockwise from left bottom: 1) Initial (2×2 mm) 2–4) Irradiated by different doses of 2-MeV electrons 5–6) Irradiated by different doses and annealed at 800 °C. Isolated vacancy is the most studied defect in diamond, both experimentally and theoretically. Its most important practical property is optical absorption, like in the color centers, which gives diamond green, or sometimes even green–blue color (in pure diamond).
|
|
The annealing process for dual -phase steels consists of first holding the steel in the alpha + gamma temperature region for a set period of time. During that time C and Mn diffuse into the austenite leaving a ferrite of greater purity. The steel is then quenched so that the austenite is transformed into martensite, and the ferrite remains on cooling. The steel is then subjected to a temper cycle to allow some level of marten-site decomposition.
|
|
Compared to the laser method, this technique is simpler and more cost effective.. Plasma torch annealing is attractive because the process parameters and equipment dimension can be changed easily to yield varying levels of performance. A high level of crystallization (~90%) can be obtained with this method. Disadvantages include difficulty achieving uniformity in the crystallization of the film. While this method is applied frequently to silicon on a glass substrate, processing temperatures may be too high for polymers.
|
|
The protein encoded by this gene is a member of the SWI/SNF family of proteins. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The SMARCAL1 protein convert RPA-bound, single stranded DNA into double-stranded DNA, an enzyme activity termed "annealing helicase". The encoded protein shows sequence similarity to the E. coli RNA polymerase-binding protein HepA.
|
|
Lockheed Martin and D-Wave will collaborate to realize the benefits of a computing platform based upon a quantum annealing processor, as applied to some of Lockheed Martin's most challenging computation problems. Lockheed Martin established a multi-year contract that includes one system, maintenance and services. Potentially an important milestone for both companies. On May 28, 2011 it was reported that a cyberattack using previously stolen EMC files had broken through to sensitive materials at the contractor.
|
|
The crystals were initially found to have a hexagonal crystal structure with the lattice parameters, a = 1.169 nm, c = 2.225 nm and three formula units per unit cell, but later reassigned a face- centered cubic structure (fluorite-like). A tranquillityite-like crystalline phase has been synthesized by mixing oxide powders in an appropriate ratio, determined from the chemical analysis of the lunar samples, and annealing the mixture at . This phase was not pure, but intergrown with various intermetallic compounds.
|
|
This process does not introduce any more mutations than a normal round of replication would. Scanning electron microscopy analysis has shown that DNA in D. radiodurans is organized into tightly packed toroids, which may facilitate DNA repair. A team of Croatian and French researchers led by Miroslav Radman have bombarded D. radiodurans to study the mechanism of DNA repair. At least two copies of the genome, with random DNA breaks, can form DNA fragments through annealing.
|
|
Dynamic recrystallization is the process of removing the internal strain that remains in grains during deformation. This happens by the reorganization of a material with a change in grain size, shape, and orientation within the same mineral. When recrystallization occurs after deformation has come to an end and particularly at high temperatures, the process is called static recystallization or annealing. Dynamic recystallization results in grain size-reduction and static recystallization results in the formation of larger equant grains.
|
|
Pure diamonds, before and after irradiation and annealing. Clockwise from left bottom: 1) Initial (2×2 mm) 2–4) Irradiated by different doses of 2-MeV electrons 5–6) Irradiated by different doses and annealed at 800 °C. Irradiation of diamond by high-energy particles (electrons, ions, neutrons or gamma rays) produces vacancies in the diamond lattice by ejecting carbon atoms. Those vacancies produce green color centers in pure transparent diamond and yellow-green color in yellow diamonds.
|
|
The color of yellow diamonds results from small numbers of nitrogen atoms replacing carbon in the lattice. Heating the irradiated diamonds to temperatures above 600 °C results in brown color associated with aggregation of the vacancies, with or without nitrogen involved. Such irradiation and annealing treatment can occur in nature because diamonds are often accompanied by uranium-containing ores which emit alpha particles. However, the thus produced color is restricted to a thin surface layer of few micrometers.
|
|
Post-deposition annealing of contacts is useful for relieving stress as well as for inducing any desirable reactions between the metal and the semiconductor. Because deposited metals can themselves oxidise in ambient conditions, to the detriment of the contacts' electrical properties, it is common to form ohmic contacts with layered structures. The bottom layer, in contact with the semiconductor, is chosen for its ability to induce ohmic behaviour. The top layer is chosen for its low reactivity.
|
|
Copper is known to have been traded from the Great Lakes region to other parts of North America. However, there were also other sources of copper, including in the Appalachian Mountains near the Etowah Site in Georgia.Welch (1991), Moundville's Economy : 184 The Mississippian copper plates were made by a process of annealing. Ancient copper artifacts are found over a very wide range, all around the Great Lakes region, and far south into what is now the USA.
|
|
In 2011, researchers reported making fibers using chemical vapor deposition grown graphene films. The method was scalable and controllable, delivering tunable morphology and pore structure by controlling the evaporation of solvents with suitable surface tension. Flexible all-solid-state supercapacitors based on such fibers were demonstrated in 2013. In 2015 intercalating small graphene fragments into the gaps formed by larger, coiled graphene sheets after annealing provided pathways for conduction, while the fragments helped reinforce the fibers.
|
|
Once the annealing process is successfully completed, workpieces are sometimes left in the oven so the parts cool in a controllable way. While some workpieces are left in the oven to cool in a controlled fashion, other materials and alloys are removed from the oven. Once removed from the oven, the workpieces are often quickly cooled off in a process known as quench hardening. Typical methods of quench hardening materials involve media such as air, water, oil, or salt.
|
|
Graphene sheets have been reported to be grown by dosing ethylene onto the clean, single platinum(111) substrate at temperatures above 1000 °C in ultra-high vacuum (UHV). Graphene monolayer interacts weakly with the Pt(111) surface below it confirmed by the local density of states which is a ‘V’ shape. Kim et al., reported the electronic properties of the graphene nanoislands whose geometry is affected by varying the annealing temperatures and providing a fundamental understanding on graphene growth.
|
|
Accelerating carbon ions under an electrical field into a semiconductor made of thin Ni films on a substrate of SiO2/Si, creates a wafer-scale () wrinkle/tear/residue-free graphene layer that changes the semiconductor's physical, chemical and electrical properties. The process uses 20 keV and a dose of 1 × 1015 cm−2 at a relatively low temperature of 500 °C. This was followed by high-temperature activation annealing (600–900 °C) to form an sp2-bonded structure.
|
|
These helicases, through their ability to unwind D-loop intermediates, promote NCO recombination by the process of synthesis-dependent strand annealing. In the plant Arabidopsis thaliana, FANCM helicase promotes NCO and antagonizes the formation of CO recombinants. Another helicase, RECQ4A/B, also independently reduces COs. It was suggested that COs are restricted because of the long term costs of CO recombination, that is, the breaking up of favorable genetic combinations of alleles built up by past natural selection.
|
|
E. coli SOS System: DNA can be damaged by cross-linking agents, UV irradiation, alkylating agents, etc. Once damaged, RecA, a LexA protease, senses that damaged protein and becomes activated by removing its repressor. Once the LexA dimer repressor is removed, the expression of LexA operon is autoregulatory. In addition to being a LexA protease, the RecA protein also catalyzes a few novel DNA reactions such as annealing of single-stranded DNA and transfer of strands.
|
|
The most commonly used ceramic material in IR radiation microbolometers is vanadium oxide. The various crystalline forms of vanadium oxide include both VO2 and V2O5. Deposition at high temperatures and performing post-annealing allows for the production of thin films of these crystalline compounds with superior properties, which may be easily integrated into the fabrication process. VO2 has low resistance but undergoes a metal- insulator phase change near 67 °C and also has a lower TCR value.
|
|
A biochemical assay system shows that at least 6 genes are required for microhomology-mediated end joining: FEN1, Ligase III, MRE11, NBS1, PARP1 and XRCC1. All six of these genes are up-regulated in one or more cancers. In humans, DNA polymerase theta, encoded by the POLQ gene, plays a central role in microhomology-mediated end joining. Polymerase theta utilizes its helicase domain to displace replication protein A (RPA) from DNA ends and promote microhomology annealing.
|
|
In hubbing, a male hub (master) is created with a profile that will form an impression on the female piece. The male hub is generally hardened and the female die block softened by annealing to help form the impression. As the metal flows the face of the die block is deformed, and, generally, must be machined flat. The die block is often a cylinder that is reinforced with a surrounding steel ring during the hubbing process.
|
|
To prepare a sample of lutetium tantalate, powders of lutetium and tantalum oxides (Lu2O3 and Ta2O5) are mixed and annealed at a temperature above 1200 °C for several hours. To prepare a phosphor, a small fraction of appropriate material, such as an oxide of another rare-earth metal, is added to the mixture before annealing. After cooling, the product is leached with water, washed, filtered and dried, resulting in a white powder consisting of micrometre-sized particles of LuTaO4.
|
|
Polymerase cycling assembly (or PCA, also known as Assembly PCR) is a method for the assembly of large DNA oligonucleotides from shorter fragments. The process uses the same technology as PCR, but takes advantage of DNA hybridization and annealing as well as DNA polymerase to amplify a complete sequence of DNA in a precise order based on the single stranded oligonucleotides used in the process. It thus allows for the production of synthetic genes and even entire synthetic genomes.
|
|
Liquid-based syntheses are efficient and typically better for the environment. The simplest and most economical method, in which components of the nanocrystal are mixed together in solution and allowed to precipitate. This method yields nanoparticles with a narrow size distribution (around 100 nm), but that lack the precision of more intricate methods, thereby requiring more post-synthesis work up. NPs can be improved with an annealing step at high temperatures, but this often leads to aggregation, limiting applications.
|
|
While the glass was being poured into the mold during the first attempt to cast the 200-inch mirror, the intense heat caused several of the molding blocks to break loose and float to the top, ruining the mirror. The defective mirror was used to test the annealing process. After the mold was re-engineered, a second mirror was successfully cast. After cooling several months, the finished mirror blank was transported by rail to Pasadena, California.
|
|
An official online document of the Royal Swedish Academy of Sciences about this awarding got under fire. Walter de Heer mentions several objections about the work of Geim and Novoselov who apparently have measured on many-layer graphene, also called graphite, which has different electronic and mechanical properties. Emtsev et al. improved the whole procedure in 2009 by annealing the SiC-samples at high temperatures over 1650 °C in an argon environment to obtain morphologically superior graphene.
|
|
Metallic and semiconducting carbon nanotubes generally coexist in as-grown materials. To get only semiconducting or only metallic nanotubes selective functionalization of metallic SWNTs via 4-hydroxybenzene diazonium can be used. Separation can be done in solution by deprotonation of the p-hydroxybenzene group on the reacted nanotubes (metallic) in alkaline solution followed by electrophoretic separation of these charged species from the neutral species (semiconducting nanotubes). This followed by annealing would give separated pristine semiconducting and metallic SWNT.
|
|
230 to 250 °C for zircon, and c. 300 °C for titanite. Because heating of a sample above the annealing temperature causes the fission damage to heal or anneal, the technique is useful for dating the most recent cooling event in the history of the sample. This resetting of the clock can be used to investigate the thermal history of basin sediments, kilometer-scale exhumation caused by tectonism and erosion, low temperature metamorphic events, and geothermal vein formation.
|
|
This method relies on PCR to differentially amplify non-homologous DNA regions between digested fragments of two nearly identical DNA species, that are called 'driver' and 'tester' DNA. Typically, tester DNA contains a sequence of interest that is non-homologous to driver DNA. When the two species are mixed, the driver sequence is added in excess to tester. During PCR, double stranded fragments first denature at ~95°C and then re-anneal when subjected to the annealing temperature.
|
|
These chromosomes (paired chromatids) then pair with the homologous chromosome (also paired chromatids) present in the same nucleus (see prophase I in the meiosis diagram). The process of alignment of paired homologous chromosomes is called synapsis (see Synapsis). During synapsis, genetic recombination usually occurs. Some of the recombination events occur by crossing over (involving physical exchange between two chromatids), but most recombination events involve information exchange but not physical exchange between two chromatids (see Synthesis-dependent strand annealing (SDSA)).
|
|
The process steps most often associated with process simulation are ion implantation, annealing (diffusion and dopant activation), etch, deposition, oxidation, and epitaxy. Other common steps include chemical- mechanical planarization (CMP), silicidation, and reflow. All commercial process simulators use a combination of the finite element analysis (FE) and/or finite volume methods (FV) methods. A complete description of FE/FV method is out of the scope of this article but there are many fine books which describe the topic thoroughly.
|
|
For most applications, dewetting is an unwanted process, because it destroys the applied liquid film. Dewetting can be inhibited or prevented by photocrosslinking the thin film prior to annealing, or by incorporating nanoparticle additives into the film.Carroll, Gregory T.; Turro, Nicholas J.; Koberstein, Jeffrey T. (2010) Patterning Dewetting in Thin Polymer Films by Spatially Directed Photocrosslinking Journal of Colloid and Interface Science, Vol. 351, pp 556-560 Surfactants can have a significant effect on the spreading coefficient.
|
|
Recovery is related to the similar process of recrystallization and grain growth, each of them being stages of annealing. Recovery competes with recrystallization, as both are driven by the stored energy, but is also thought to be a necessary prerequisite for the nucleation of recrystallized grains. It is so called because there is a recovery of the electrical conductivity due to a reduction in dislocations. This creates defect-free channels, giving electrons an increased mean-free path.
|
|
Instead of mixing recycled metal with more aluminum (to soften it) or magnesium (to harden it), a new approach uses annealing to produce an alloy that works for both. The aluminum can is also considered the most valuable recyclable material in an average recycling bin. It is estimated that Americans throw away nearly 1 billion dollars a year in wasted aluminum. The aluminum industry pays nearly 800 million dollars a year for recycled aluminum since it is so versatile.
|
|
The regularity of such crystals can sometimes be improved with macromolecular crystal annealing and other methods. However, in many cases, obtaining a diffraction-quality crystal is the chief barrier to solving its atomic-resolution structure. Small-molecule and macromolecular crystallography differ in the range of possible techniques used to produce diffraction-quality crystals. Small molecules generally have few degrees of conformational freedom, and may be crystallized by a wide range of methods, such as chemical vapor deposition and recrystallization.
|
|
An important problem involved with this solution is the possibility of local minima. This can occur if nodes are in a situation that is optimal only considering a local neighborhood, while ignoring the possibility of a higher optimality resulting from swaps with distant nodes. In the above paper, the authors proposed a simulated annealing method where less-than-optimal swaps were made with a small probability. This probability was proportional to the value of making the switches.
|
|
MSH5 mutants retain the competence to repair DNA double-strand breaks that are present during meiosis, but they accomplish this repair in a way that does not lead to crossovers between homologous chromosomes. The known mechanism of non- crossover recombinational repair is called synthesis dependent strand annealing (see homologous recombination). MSH5 thus appears to be employed in directing the recombinational repair of some double-strand breaks towards the cross over option rather than the non-cross over option.
|
|
Duplex sequencing tagged adapters can be used in combination with majority of NGS adapters. In the figures and workflow section of this article Illumina sequencing adapters are used as an example in accordance to the original published protocol. Figure 1) Duplex sequencing library preparation workflow: Two adapter oligos go through several steps (Annealing, Synthesis, dT-tailing) to generate double stranded unique tags with 3'-dT-overhangs. Then the duplex tag adapters ligate to the double stranded DNA templates.
|
|
HPCVD has been the most effective technique for depositing magnesium diboride (MgB2) thin films. Other MgB2 deposition technologies either have a reduced superconducting transition temperature and poor crystallinity, or require ex situ annealing in Mg vapor. The surfaces of these MgB2 films are rough and non-stoichiometric. Instead, HPCVD system can grow high-quality in situ pure MgB2 films with smooth surfaces, which are required to make reproducible uniform Josephson junctions, the fundamental element of superconducting circuits.
|
|
Often only a small modification needs to be made to the standard PCR protocol to achieve a desired goal: Multiplex-PCR uses several pairs of primers annealing to different target sequences. This permits the simultaneous analysis of multiple targets in a single sample. For example, in testing for genetic mutations, six or more amplifications might be combined. In the standard protocol for DNA Fingerprinting, the targets assayed are often amplified in groups of 3 or 4.
|
|
The procedure begins with a chimeric DNA oligonucleotide annealing to the target RNA around the candidate modification site. The chimeric ssDNA has 2’OMe/2’H modifications and is complementary to the target sequence. The chimeric oligonucleotide serves as a guide to allow RNase H to cleave the RNA strand precisely at the 5’-end of the candidate site. The cut site is then radiolabeled with phosphorus-32 and splint-ligated to a 116nt ssDNA oligonucleotide using DNA ligase.
|
|
The scientific method can be regarded as containing an element of trial and error in its formulation and testing of hypotheses. Also compare genetic algorithms, simulated annealing and reinforcement learning – all varieties for search which apply the basic idea of trial and error. Biological evolution can be considered as a form of trial and error. Random mutations and sexual genetic variations can be viewed as trials and poor reproductive fitness, or lack of improved fitness, as the error.
|
|
The current-carrying capacity, or ampacity, of overhead lines starts with the type of conductor used. The conductor choice determines its electrical resistance and other physical parameters for dynamic line rating (DLR). Electric current passing through the conductor causes heating according to Joule's first law, resulting in the conductor expanding and the line sagging. Transmission ratings are set with a maximum allowable conductor temperature (annealing temperature) and minimum clearance rules to comply with legislation and regulation.
|
|
His current work focuses on adiabatic quantum computing and quantum annealing, areas where he has made widely cited contributions to studying the capabilities of the D-Wave Systems processors. His past interests include scattering theory and fractals. Lidar's research in quantum information processing has focused primarily on methods for overcoming decoherence. He wrote some of the founding papers on decoherence-free subspaces, most notably his widely cited paper "Decoherence-free subspaces for quantum computation", and their generalization, noiseless subsystems.
|
|
Yuri Leonidovich Belousov (Russian: Ю́рий Леони́дович Бело́усов; November 14, 1945 Chelyabinsk Oblast, USSR — May 4, 2000, Yekaterinburg), Sverdlovsk Oblast, Russia, was a researcher and engineer in the field of Materials Science: glass and Glass-ceramic technologies. Yuri Belousov authored or co- authored numerous books and publications, and earned more than 10 patents and inventions related to new glass-ceramic materials, colored glasses, foam glass and ceramic glazes with high thermal shock resistance for carbon containing materials. His main achievements, which were developed in the USSR, include a unique method of glass annealing and toughening (together with O.V. Mazurin; see toughened glass, annealing (glass)), obtaining the first USSR free-dust method of sealing of glass ampoules which prevented the ingress of glass dust into medicinal ampouled preparations (in collaboration with O.V. Mazurin and others). Yuri Belousov is also the main author and creator of a theoretical method of determining viscosity of silicate melts, allowing one to perform theoretical calculations of viscosity and thus predict commercial glass, cement and slag compositions.
|
|
As the iron is mobile, islands can merge if left too long at the growth temperature before initiating nanotube growth. Annealing at the growth temperature reduces the site density #/mm2 and increases the diameter of the nanotubes. As the nanotubes grow from the catalyst islands, the crowding effects and van der Waals forces between other CNTs leave them no choice to grow in any direction but vertically to the substrate. The height of vertically aligned CNTs varies with catalyst particle spacing as well.
|
|
Irradiation forms vaccines in the diamond structure while vacuum-annealing migrates these vacancies, which will get trapped by nitrogen atoms within the nanodiamond. This process produces two types of NV centers. Two types of NV centers are formed—neutral (NV0) and negatively charged (NV–)—and these have different emission spectra. The NV– centre is of particular interest because it has an S = 1 spin ground state that can be spin-polarized by optical pumping and manipulated using electron paramagnetic resonance.
|
|
The assumed mechanism is trapping of migrating vacancy by substitutional silicon resulting in the Si-V (semi-divacancy) configuration. A similar mechanism is expected for nickel, for which both substitutional and semi-divacancy configurations are reliably identified (see subsection "nickel and cobalt" above). In an unpublished study, diamonds rich in substitutional nickel were electron irradiated and annealed, with following careful optical measurements performed after each annealing step, but no evidence for creation or enhancement of Ni-vacancy centers was obtained.
|
|
The layered intermetallic materials derived from the Cu2Sb-type structure are attractive anode materials due to the open gallery space available and structural similarities to the discharge Li2CuSb product. First reported in 2001 . In 2011, researchers reported a method to create porous three dimensional electrodes materials based on electrodeposited antimony onto copper foams followed by a low temperature annealing step. It was noted to increase the rate capacity by lowering the lithium diffusion distances while increasing the surface area of the current collector.
|
|
A target sequence and a probe are essential in FISH. First, the probe is labeled with either direct or indirect labeling strategy: hapten-modified nucleotides are used in indirect labeling, and fluorophore-modified nucleotides are used in direct labeling. The target DNA and probes are denatured and mixed, allows the re-annealing of DNA sequences. Indirect labeling requires an extra step to produce visualized signals that requires use of enzymatic or immunological system, but provides greater signal amplification than direct labeling.
|
|
Porous organosilicate materials are usually obtained by a two-step procedure where the first step consists of the co-deposition of a labile organic phase (known as porogen) together with an organosilicate phase resulting in an organic-inorganic hybrid material. In the second step, the organic phase is decomposed by UV curing or annealing at a temperature of up to 400°C, leaving behind pores in the organosilicate low-κ materials. Porous organosilicate glasses have been employed since the 45 nm technology node.
|
|
Figure 4. Double-strand break repair models that act via homologous recombination Two primary models for how homologous recombination repairs double-strand breaks in DNA are the double- strand break repair (DSBR) pathway (sometimes called the double Holliday junction model) and the synthesis-dependent strand annealing (SDSA) pathway. The two pathways are similar in their first several steps. After a double- strand break occurs, the MRX complex (MRN complex in humans) binds to DNA on either side of the break.
|
|
Figure 6. Recombination via the SSA pathway occurs between two repeat elements (purple) on the same DNA duplex, and results in deletions of genetic material. (Click to view animated diagram in Firefox, Chrome, Safari, or Opera web browsers.) The single-strand annealing (SSA) pathway of homologous recombination repairs double-strand breaks between two repeat sequences. The SSA pathway is unique in that it does not require a separate similar or identical molecule of DNA, like the DSBR or SDSA pathways of homologous recombination.
|
|
Cockerill 105 HP Gun The company's primary business is in metal mechanical engineering with emphasis on machinery related to or using in steelworks; maintenance, refurbishment and repair of equipment is also part of the companies business. The industry sub-division manufactures equipment for steel coil treatment including pickling, annealing, hot dip and electro galvanising lines, rolling mills and reheating furnaces for the steel industry., as well as shunting locomotives. The energy sub- division products include heat recovery steam generator and boilers.
|
|
It can then be embellished or decorated using a variety of techniques and materials. All parts of the workpiece must be kept at similar temperatures lest they shatter. Once finished the piece must be annealed in an kiln to prevent cracking or shattering. Annealing, in glass terms, is heating a piece until its temperature reaches a stress-relief point, that is, a temperature at which the glass is still too hard to deform, but is soft enough for internal stresses to ease.
|
|
His invention of Nano-Pocket LEDs is the key architecture utilized in the efficient Gallium Nitride-based light emitting diodes. In the late 1970s Narayan pioneered in solute trapping of dopants in semiconductor materials with his discoveries of nanosecond laser annealing. This extensive solute trapping above the retrograde solubility limits resulted in formation of supersaturated semiconductor alloys used in current integrated circuits. This discovery resulted in him receiving US Department of Energy award in 1981 and IR-100 award in 1983.
|
|
Initially the company processed steel by cold rolling, annealing and other processes, using stainless steel imported from the USA. Later the plant expanded to include casting, and an electric foundry installed in 1970. Cast stainless blocks were produced at the factory and sent to the Espérance-Longdoz plant in Chertal, Liege for conversion to slab, they then returned to ALZ for rolling. Continuous cast stainless steel production was introduced in the mid-1970s, eliminated the need to have slabbing done at Chertal.
|
|
The training mode is used for training (adapting) the system, or more generally to start the control system that regulates the information flow. It is visually similar to design mode and the same components are displayed. As the components have support for context sensitive displays, they can have a different visual appearance in training. In addition to running the control system, training mode allows the execution of high- level optimizers such as genetic algorithms, particle swarm optimization and simulated annealing.
|
|
Double-strand break repair models that act via homologous recombination Homology directed repair (HDR) is a mechanism in cells to repair double-strand DNA lesions. The most common form of HDR is homologous recombination. The HDR mechanism can only be used by the cell when there is a homologous piece of DNA present in the nucleus, mostly in G2 and S phase of the cell cycle. Other examples of homology-directed repair include single-strand annealing and breakage-induced replication.
|
|
The annealing process took much longer than it did for plate glass, often lasting three to five days. This left the glass very strong, with a compressive strength about 40 percent greater than marble. If the product was to be affixed to another surface (such as the exterior of a building), one side of the slab was grooved before the glass hardened. The exposed side(s) of the material was flame polished, which left the product highly reflective and brilliant.
|
|
Both were installed in 1953 by United and had a combined annual capacity of 120,000 tons. The cold anneal and pickle line were installed in 1975 by Production Machinery. The line consisted of an entry end washing section to remove rolling oils, an open air annealing furnace (where the strip was heated above ), and three acid pickling tanks followed by rinsing and drying units. Paper was interleaved between the coil wraps at the exit take up reel to avoid surface abrasion.
|
|
Fe - Cr Phase diagram To qualify as stainless steel, Fe-base alloys must contain at least 10.5%Cr. The Iron-Chromium phase diagram shows that up to about 13%Cr, the steel undergoes successive transformations upon cooling from the liquid phase from ferritic α phase to austenitic γ phase and back to α. When some carbon is present, and if cooling occurs quickly, some of the austenite will transform into martensite.Tempering/annealing will transform the martensitic structure into ferrite and carbides.
|
|
It must be high enough to allow for rearrangement and annealing of atoms during the synthesis process while being low enough to promote crystal growth. The concentration of monomers is another critical factor that has to be stringently controlled during nanocrystal growth. The growth process of nanocrystals can occur in two different regimes, "focusing" and "defocusing". At high monomer concentrations, the critical size (the size where nanocrystals neither grow nor shrink) is relatively small, resulting in growth of nearly all particles.
|
|
Multiple displacement amplification (MDA) is a DNA amplification technique. This method can rapidly amplify minute amounts of DNA samples to a reasonable quantity for genomic analysis. The reaction starts by annealing random hexamer primers to the template: DNA synthesis is carried out by a high fidelity enzyme, preferentially Φ29 DNA polymerase. Compared with conventional PCR amplification techniques, MDA does not employ sequence-specific primers but amplifies all DNA, generates larger sized products with a lower error frequency, and works at a constant temperature.
|
|
The resulting experimental profile can be matched to theoretical structures by Rietveld refinement or simulated annealing. Adding the two-valued symmetry is also a useful concept for frieze groups which are often used to classify artistic patterns. In that case, the 7 frieze groups with the addition of color reversal become 24 color-reversing frieze groups. Beyond simple the simple two-valued property, the idea has been extended further to three colors in three dimensions, and to even higher dimensions and more colors.
|
|
The Edward Curran Engineering Co. was founded in Cardiff in 1903 by Edward Curran, whose father Charles was an Irish stonemason who had settled in Cardiff, then a thriving coal port. Edward Curran was also a stonemason. The company opened a foundry in Hurman street, Butetown, in or adjacent to the site of the former Bute Shipbuilding and Engineering Works . The firm initially specialised in producing furnaces for annealing metals, one of which was built for Mountstuart Dry Docks in Cardiff in 1909.
|
|
Heteroduplexes and homoduplexes formed after amplification and re-annealing of wild type and mutant alleles Heteroduplex analysis (HDA) is a method in biochemistry used to detect point mutations in DNA since 1992. Heteroduplexes are dsDNA molecules that have one or more mismatched pairs, on the other hand homoduplexes are dsDNA which are perfectly paired. This method of analysis depend up on the fact that heteroduplexes shows reduced mobility relative to the homoduplex DNA. heteroduplexes are formed between different DNA alleles.
|
|
Because of the astronomical number of possible cladograms, algorithms cannot guarantee that the solution is the overall best solution. A nonoptimal cladogram will be selected if the program settles on a local minimum rather than the desired global minimum. To help solve this problem, many cladogram algorithms use a simulated annealing approach to increase the likelihood that the selected cladogram is the optimal one. The basal position is the direction of the base (or root) of a rooted phylogenetic tree or cladogram.
|
|
His and his collaborator's theory of strongly correlated superconductivity was recently confirmed in compounds such as Cs3C60. Pioneering papers on quantum annealing are now basic to current developments in quantum computing. More recently he moved on to the theory of nanofriction, a field where he obtained the ERC Advanced Grant MODPHYSFRICT 2013-2019, and subsequently, as co-PI with an experimental group, another ERC Advanced Grant ULTRADISS 2019-2024 . More details of his current and past research activity can be found here.
|
|
One definition refers to the viscosity, fixing Tg at a value of 1013 poise (or 1012 Pa·s). As evidenced experimentally, this value is close to the annealing point of many glasses. In contrast to viscosity, the thermal expansion, heat capacity, shear modulus, and many other properties of inorganic glasses show a relatively sudden change at the glass transition temperature. Any such step or kink can be used to define Tg. To make this definition reproducible, the cooling or heating rate must be specified.
|
|
With Bernd Matthias of UCSD, she started to work on metal cluster formation in superconducting ternary transition metal compounds. Her extensive knowledge of structural inorganic chemistry enabled her to predict inorganic crystal structures and led to the discovery the superconducting rare earth ternary borides. In 1980 she changed direction and began research on contact metallization on InGaAsP/InP multi-quantum well layers used as high speed digital lasers in the internet. She designed a temperature-dependent in- situ annealing X-ray diffractometer.
|
|
The diameters of the nanotubes that are to be grown are related to the size of the metal particles. This can be controlled by patterned (or masked) deposition of the metal, annealing, or by plasma etching of a metal layer. The substrate is heated to approximately 700 °C. To initiate the growth of nanotubes, two gases are bled into the reactor: a process gas (such as ammonia, nitrogen or hydrogen) and a carbon-containing gas (such as acetylene, ethylene, ethanol or methane).
|
|
When using solvents which evaporate at a slower rate (as chlorobenzene (CB) or dichlorobenzene (DCB)) you can get larger degrees of vertical separation or aggregation while solvents that evaporate quicker produce a much less effective vertical separation. Larger solubility gradients should lead to more effective vertical separation while smaller gradients should lead to more homogeneous films. These two effects were verified on P3HT:PCBM solar cells. The solvent evaporation speed as well as posterior solvent vapor or thermal annealing procedures were also studied.
|
|
U. maydis is not only used to study plant disease, but it also is used to study plant genetics. In 1996, a study on U. maydis genetics led to the discovery of synthesis-dependent strand annealing, a method of homologous recombination used in DNA repair. Other studies in the fungus have also investigated the role of the cytoskeleton in polarized growth. It is largely due to work with U. maydis that the function of the breast-cancer gene BRCA2 is now known.
|
|
Examples of algorithms that solve convex problems by hill- climbing include the simplex algorithm for linear programming and binary search. To attempt to avoid getting stuck in local optima, one could use restarts (i.e. repeated local search), or more complex schemes based on iterations (like iterated local search), or on memory (like reactive search optimization and tabu search), or on memory-less stochastic modifications (like simulated annealing). The relative simplicity of the algorithm makes it a popular first choice amongst optimizing algorithms.
|
|
In jewelry making, pickling is used to remove the copper oxide layer that results from heating copper and sterling silver during soldering and annealing. A diluted sulfuric acid pickling bath is traditionally used, but may be replaced with citric acid. Sheet steel that undergoes acid pickling will oxidize (rust) when exposed to atmospheric conditions of moderately high humidity. For this reason, a thin film of oil or similar waterproof coating is applied to create a barrier to moisture in the air.
|
|
The purpose is to soften higher carbon steels and allow more formability. This is the softest and most ductile form of steel.Smith, p. 388 ; Full annealing: Carbon steel is heated to approximately 40 °C above Ac3 or Acm for 1 hour; this ensures all the ferrite transforms into austenite (although cementite might still exist if the carbon content is greater than the eutectoid). The steel must then be cooled slowly, in the realm of 20 °C (36 °F) per hour.
|
|
The major applications of YOYO-1 are for DNA staining. Under normal conditions and pH level, the four positive charge of each YOYO-1 molecule makes it very easy to bind to DNA molecules which have negatively charged backbones. The dye then readily intercalates into the DNA either with one end or two ends depending on the annealing temperature and room available. The DNA then lights up under a fluorescence microscope with very small background from the unbound YOYO-1.
|
|
Roth studied computer science and engineering at the University of Mannheim, obtaining his diplom in 2001. The title of his thesis was "Analysis of a Deterministic Annealing Method for Graph Matching and Quadratic Assignment Problems in Computer Vision".Diplom thesis of Stefan Roth from the website of the Technische Universität Darmstadt He then studied computer science at Brown University, where he received his Masters degree. In 2007, he received his PhD in computer science under Michael Julian Black from the same institution.
|
|
The flexural modulus of PLA is higher than polystyrene and PLA has good heat sealability. Several technologies such as annealing, adding nucleating agents, forming composites with fibers or nano- particles, chain extending and introducing crosslink structures have been used to enhance the mechanical properties of PLA polymers. Polylactic acid can be processed like most thermoplastics into fiber (for example, using conventional melt spinning processes) and film. PLA has similar mechanical properties to PETE polymer, but has a significantly lower maximum continuous use temperature.
|
|
Upon annealing, crystallization starts from the portion of a-Si which is covered by metal and proceeds laterally. Unlike MIC process, where metal contamination in the obtained polysilicon is relatively high, the laterally crystallized silicon in MILC process contains very small amount of metal contamination. The crystallization speed is low, but is adequate for applications such as fabrication of thin film transistors. In this case, metal is deposited on the source/drain area of the transistor and the channel is laterally crystallized.
|
|
Tinplate made via hot-dipped tin plating is made by cold rolling steel or iron, pickling to remove any scale, annealing to remove any strain hardening, and then coating it with a thin layer of tin. Originally this was done by producing individual or small packs of plates, which became known as the pack mill process. In the late 1920s strip mills began to replace pack mills, because they could produce the raw plates in larger quantities and more economically.
|
|
The tantalum - nitrogen system includes several states including a nitrogen solid solution in Tantalum, as well as several nitride phases, which can vary from expected stoichiometry due to lattice vacancies. Annealing of nitrogen rich "TaN" can result in conversion to a two phase mixture of TaN and Ta5N6. Ta5N6 is thought to be the more thermally stable compound - though it decomposes in vacuum at 2500C to Ta2N. It was reported the decomposition in vacuum from Ta3N5 via Ta4N5, Ta5N6, ε-TaN, to Ta2N.
|
|
In no-SCAR genome editing, both the pCas9cr4 and pKDsg-XXX plasmids are sequentially transformed into E. coli cells. Upon induction of the λ-red recombination machinery, linear DNA to be inserted into the E. coli target sequence can be transformed into the cells through electroporation. Expression of Cas9 and sgRNA is induced, resulting in Cas9-mediated cleavage of the targeted E. coli genome and subsequent λ-red- mediated homologous recombination and annealing of the linear DNA to the target sequence.
|
|
The latter is left behind as water-soluble crystalline deposits, or bloom, on the glass surface that must be rinsed away prior to filling. On manufacturing lines, one way in which this process was done was by flooding the annealing lehr with sulfur dioxide (SO2) or sulfur trioxide (SO3) gases—especially in the presence of water, which enhances the reaction. However, this practice fell into disfavor due to environmental and health concerns regarding SOx-type gases.Ryder, R. J., Poad,W.
|
|
Following annealing when replication occurs, the DNA is extended by a new sequence that is complementary to the molecule it is to be joined to. Once both DNA molecules are extended in such a manner, they are mixed and a PCR is carried out with only the primers for the far ends. The overlapping complementary sequences introduced will serve as primers and the two sequences will be fused. This method has an advantage over other gene splicing techniques in not requiring restriction sites.
|
|
Microscopic mechanical elements such as micromotors, micropumps, and other microfluidic devices can be produced using direct-write concepts. In addition to additive and subtractive processes, LDW allows for the modification of the properties of a material. Mechanisms that allow for these modifications include sintering, microstereolithography, and multiphoton processes. These use a series of laser pulses to deliver a precise amount of energy to induce a physical or chemical change that can result in annealing and surface structuring of a material.
|
|
The second heating scan will differ from the first heating scan because of thermal relaxation during the first scan and the equilibration achieved during the cooling scan. A second cooling scan followed by a third heating scan can be performed to check on the reliability of the prior scans. Different heating and cooling rates can be used to produce different equilibrations. Annealing at specific temperatures can be used to provide different isothermal relaxations that can be measured by a subsequent heating scan.
|
|
Retrieved on 2013-08-07. Evolver was sold to Palisade in 1997, translated into several languages, and is currently in its 6th version.Evolver: Sophisticated Optimization for Spreadsheets. Palisade. Retrieved on 2013-08-07. Since the 1990s, MATLAB has built in three derivative-free optimization heuristic algorithms (simulated annealing, particle swarm optimization, genetic algorithm) and two direct search algorithms (simplex search, pattern search).Benchmarks for Evaluating Optimization Algorithms and Benchmarking MATLAB Derivative-Free Optimizers for Practitioners’Rapid Access, IEEE Access, vol.7, 2019.
|
|
From the glazer, the product is placed on a lehr (a long conveyor inside an oven) where the glass is gradually cooled—a process called annealing. At the far end of the lehr, packers remove the glass and get it ready for shipping. In 1931, Indiana Glass employee Jeddiah B. Clark received a patent for an improved process for transferring molten glass (or gobs) to glass blowing or pressing machines.US patent 1,807,336, "Glass Gob Disposing Means", issued 1931-05-26.
|
|
USC and ISI researchers, as well as Lockheed Martin engineers, seek to develop methods to benchmark quantum annealers, and perform tests of quantumness. These include the study of quantum entanglement and, more generally, the performance of quantum annealing experiments. Researchers also are working to manage quantum decoherence, the phenomenon that degrades the performance of quantum information processors when quantum states are forced out of quantum superposition. Decoherence can reduce quantum functionality to that of a classical computer, and can be counteracted using quantum error correction.
|
|
A current model of meiotic recombination, initiated by a double-strand break or gap, followed by pairing with a homologous chromosome and strand invasion to initiate the recombinational repair process. Repair of the gap can lead to crossover (CO) or non-crossover (NCO) of the flanking regions. CO recombination is thought to occur by the Double Holliday Junction (DHJ) model, illustrated on the right, above. NCO recombinants are thought to occur primarily by the Synthesis Dependent Strand Annealing (SDSA) model, illustrated on the left, above.
|
|
The entire site had been sold to C. Reiss Coal with agreement the Vollrath would clear the site. In 1918 new additions were added to the south end of the finishing and enameling shops. In 1919 the office building and gate lodge (then known as the watchman's house) were constructed; in 1920 the power house was built. In 1922 the carton shed was added onto the building that was known as hay storage and the machine shop and annealing room were added in 1923.
|
|
Typical structure of a selenium rectifier Selenium rectifiers are made from stacks of aluminum or steel plates coated with about 1 μm of bismuth or nickel. A much thicker layer of selenium (50 to 60 μm) doped with a halogen is deposited on top of the thin metal plating. The selenium is then converted into polycrystalline gray (hexagonal) form by annealing. Cadmium selenide forms by reaction of the selenium with the tin- cadmium alloy and the CdSe-Se heterojunction is the active rectifying junction.
|
|
A current model of meiotic recombination, initiated by a double-strand break or gap, followed by pairing with an homologous chromosome and strand invasion to initiate the recombinational repair process. Repair of the gap can lead to crossover (CO) or non-crossover (NCO) of the flanking regions. CO recombination is thought to occur by the Double Holliday Junction (DHJ) model, illustrated on the right, above. NCO recombinants are thought to occur primarily by the Synthesis Dependent Strand Annealing (SDSA) model, illustrated on the left, above.
|
|
RNaseH enzymes are the primary proteins responsible for the dissolution of R-loops, acting to degrade the RNA moiety in order to allow the two complementary DNA strands to anneal. Research over the past decade has identified more than 50 proteins that appear to influence R-loop accumulation, and while many of them are believed to contribute by sequestering or processing newly transcribed RNA to prevent re-annealing to the template, mechanisms of R-loop interaction for many of these proteins remain to be determined.
|
|
Instead of using sulfated molecules or the fairly big Buckminster fullerenes recently it became possible to synthesize crystals from the hydrocarbon picene and phenanthrene. Doping the crystal Picene and Phenanthrene with some alkali metals such as potassium or rubidium and annealing for several days leads to superconductivity with transition temperatures up to 18 K. For the AxPhenanthrene, the superconductivity is possible unconventional. Both phenanthrene and picene are called phenanthrene- edge-type polycyclic aromatic hydrocarbon. The increasing number of benzene rings results in higher Tc.
|
|
Different methods (called enrichment methods) have been developed to improve accessibility to endogenous DNA in ancient remains. These approaches can mainly be divided into three types: those used during library construction, by preferentially incorporating aDNA fragments characterised by the high level of damage, those applied after library construction, by separating exogenous and endogenous fractions through annealing to pre-defined sets of probes (in solution or on microarrays), or those based on targeted digestion of environmental microbial DNA using restriction enzymes and primer extension capture (PEC).
|
|
After annealing is complete, leftover non-homologous flaps of the 3' overhangs are cut away by a set of nucleases, known as Rad1/Rad10, which are brought to the flaps by the Saw1 and Slx4 proteins. New DNA synthesis fills in any gaps, and ligation restores the DNA duplex as two continuous strands. The DNA sequence between the repeats is always lost, as is one of the two repeats. The SSA pathway is considered mutagenic since it results in such deletions of genetic material.
|
|
Imagine the state as a point in a box and the moves as a rugby-ball shaped cloud around it. The temperature and the step size are adjusted so that all of the search space is sampled to a coarse resolution in the early stages, whilst the state is directed to favorable areas in the late stages. Another ASA variant, thermodynamic simulated annealing, automatically adjusts the temperature at each step based on the energy difference between the two states, according to the laws of thermodynamics.
|
|
Both are attributes of the material that depend on their thermodynamic free energy. Heating and cooling the material affects both the temperature and the thermodynamic free energy or Gibbs energy. Simulated annealing can be used for very hard computational optimization problems where exact algorithms fail; even though it usually achieves an approximate solution to the global minimum, it could be enough for many practical problems. The problems solved by SA are currently formulated by an objective function of many variables, subject to several constraints.
|
|
In silico PCRSynonyms: digital PCR, virtual PCR, electronic PCR, e-PCR refers to computational tools used to calculate theoretical polymerase chain reaction (PCR) results using a given set of primers (probes) to amplify DNA sequences from a sequenced genome or transcriptome. These tools are used to optimize the design of primers for target DNA or cDNA sequences. Primer optimization has two goals: efficiency and selectivity. Efficiency involves taking into account such factors as GC-content, efficiency of binding, complementarity, secondary structure, and annealing and melting point (Tm).
|
|
Sometimes a filler rod may be used, but usually not. Because glass is very brittle in its solid state, it is often prone to cracking upon heating and cooling, especially if the heating and cooling are uneven. This is because the brittleness of glass does not allow for uneven thermal expansion. Glass that has been welded will usually need to be cooled very slowly and evenly through the glass transition, in a process called annealing, to relieve any internal stresses created by a temperature gradient.
|
|
The primary industrial use of boric acid is in the manufacture of monofilament fiberglass usually referred to as textile fiberglass. Textile fiberglass is used to reinforce plastics in applications that range from boats, to industrial piping to computer circuit boards. In the jewelry industry, boric acid is often used in combination with denatured alcohol to reduce surface oxidation and firescale from forming on metals during annealing and soldering operations. Boric acid is used in the production of the glass in LCD flat panel displays.
|
|
In machine learning and optimization, many algorithms are adaptive or have adaptive variants, which usually means that the algorithm parameters are automatically adjusted according to statistics about the optimisation thus far (e.g. the rate of convergence). Examples include adaptive simulated annealing, adaptive coordinate descent, AdaBoost, and adaptive quadrature. In data compression, adaptive coding algorithms such as Adaptive Huffman coding or Prediction by partial matching can take a stream of data as input, and adapt their compression technique based on the symbols that they have already encountered.
|
|
A puller rod with seed crystal for growing single-crystal silicon by the Czochralski method Crucibles used in Czochralski method Crucible after being used When silicon is grown by the Czochralski method, the melt is contained in a silica (quartz) crucible. During growth, the walls of the crucible dissolve into the melt and Czochralski silicon therefore contains oxygen at a typical concentration of 10 cm. Oxygen impurities can have beneficial or detrimental effects. Carefully chosen annealing conditions can give rise to the formation of oxygen precipitates.
|
|
A current model of meiotic recombination, initiated by a double-strand break or gap, followed by pairing with an homologous chromosome and strand invasion to initiate the recombinational repair process. Repair of the gap can lead to crossover (CO) or non-crossover (NCO) of the flanking regions. CO recombination is thought to occur by the Double Holliday Junction (DHJ) model, illustrated on the right, above. NCO recombinants are thought to occur primarily by the Synthesis Dependent Strand Annealing (SDSA) model, illustrated on the left, above.
|
|
The amount of time that the metal island can sit at the growth temperature is limited, as they are mobile, and can merge into larger (but fewer) islands. Annealing at the growth temperature reduces the site density (number of CNT/mm2) while increasing the catalyst diameter. The as-prepared carbon nanotubes always have impurities such as other forms of carbon (amorphous carbon, fullerene, etc.) and non-carbonaceous impurities (metal used for catalyst). These impurities need to be removed to make use of the carbon nanotubes in applications.
|
|
Most metals, when heated, experience a reduction in yield strength. If the material's yield strength is sufficiently lowered by heating, locations within the material that experienced residual stresses greater than the yield strength (in the heated state) would yield or deform. This leaves the material with residual stresses that are at most as high as the yield strength of the material in its heated state. Stress relief bake should not be confused with annealing or tempering, which are heat treatments to increase ductility of a metal.
|
|
During the interference stage in type I systems the PAM sequence is recognized on the crRNA-complementary strand and is required along with crRNA annealing. In type I systems correct base pairing between the crRNA and the protospacer signals a conformational change in Cascade that recruits Cas3 for DNA degradation. Type II systems rely on a single multifunctional protein, Cas9, for the interference step. Cas9 requires both the crRNA and the tracrRNA to function and cleaves DNA using its dual HNH and RuvC/RNaseH-like endonuclease domains.
|
|
Polycrystalline structure of malleable iron at 100x magnification Malleable iron is cast as white iron, the structure being a metastable carbide in a pearlitic matrix. Through an annealing heat treatment, the brittle structure as first cast is transformed into the malleable form. Carbon agglomerates into small roughly spherical aggregates of graphite leaving a matrix of ferrite or pearlite according to the exact heat treatment used. Three basic types of malleable iron are recognized within the casting industry: blackheart malleable iron, whiteheart malleable iron and pearlitic malleable iron.
|
|
A flow chart describing the processing logic used in GeNMR is shown on the right. GeNMR makes use of a number of well-known programs and databases. These include Proteus2 to perform structural modeling, PREDITOR to calculate torsion angles from chemical shifts, PPT-DB for comparative modeling and alignment and CS23D to calculate protein structures from chemical shifts only. GeNMR also uses several well- known external programs, including Rosetta for ab initio folding without NOEs and XPLOR-NIH for NOE-based simulated annealing and refinement.
|
|
They are generally made from carbon steel or stainless steel. Stainless steel belts are corrosion resistant and provide excellent surface quality. Stainless steel belts are used primarily in the chemical, food, rubber, plastic, wood, and laminate industries. Carbon steel belts are energy efficient and ideal for applications necessitating radiant heating of products or in high-temperature applications that might exceed the annealing temperatures of stainless steel belts also carbon steel belts can more evenly distributed heat since most stainless steel alloys are comparatively poor heat conductors.
|
|
In some cases, such as many aluminium alloys, an increase in strength is achieved at the expense of corrosion resistance. The addition of large amounts of nickel and chromium needed for corrosion resistance in stainless steels means that traditional hardening and tempering methods are not effective. However, precipitates of chromium, copper, or other elements can strengthen the steel by similar amounts in comparison to hardening and tempering. The strength can be tailored by adjusting the annealing process, with lower initial temperatures resulting in higher strengths.
|
|
Rapid thermal anneals are performed by equipment that heats a single wafer at a time using either lamp based heating, a hot chuck, or a hot plate that a wafer is brought near. Unlike furnace anneals they are short in duration, processing each wafer in several minutes. To achieve short annealing times and quick throughput, sacrifices are made in temperature and process uniformity, temperature measurement and control, and wafer stress. Recently, RTP-like processing has found applications in another rapidly growing field—solar cell fabrication.
|
|
In addition to this research, Thompson grows thin films to control their structure. Then with these films, he can study the nature of energy and charge propagation. He has done work on thin films made of zinc tetraphenylporphyrin (ZnTPP) which are used to prepare Organic solar cells.Chemical Annealing of Zinc Tetraphenylporphyrin Films: Effects on Film Morphology and Organic Photovoltaic Performance. Cong Trinh; Matthew T. Whited; Andrew Steiner; Christopher J. Tassone; Michael F. Toney; Mark E. Thompson, Chemistry of Materials, 2012, 24(13), 2583-2591.
|
|
The second mechanism is kinematic hardening via the accumulation of long range back stresses. Geometrically necessary dislocations can lower their free energy by stacking one atop another (see Peach-Koehler formula for dislocation-dislocation stresses) and form low-angle tilt boundaries. This movement often requires the dislocations to climb to different glide planes, so an annealing at elevated temperature is often necessary. The result is an arc that transforms from being continuously bent to discretely bent with kinks at the low-angle tilt boundaries.
|
|
A helium atom beam can even probe surfaces in the presence of electromagnetic fields and during ultra-high vacuum surface processing without interfering with the ongoing process. Because of this, helium atoms can be useful to make measurements of sputtering or annealing, and adsorbate layer depositions. Finally, because the thermal helium atom has no rotational and vibrational degrees of freedom and no available electronic transitions, only the translational kinetic energy of the incident and scattered beam need be analyzed in order to extract information about the surface.
|
|
Multiple Annealing and Looping Based Amplification Cycles (MALBAC) is a quasilinear whole genome amplification method. Unlike conventional DNA amplification methods that are non-linear or exponential (in each cycle, DNA copied can serve as template for subsequent cycles), MALBAC utilizes special primers that allow amplicons to have complementary ends and therefore to loop, preventing DNA from being copied exponentially. This results in amplification of only the original genomic DNA and therefore reduces amplification bias. MALBAC is “used to create overlapped shotgun amplicons covering most of the genome”.
|
|
DMSO is used in polymerase chain reaction (PCR) to inhibit secondary structures in the DNA template or the DNA primers. It is added to the PCR mix before reacting, where it interferes with the self-complementarity of the DNA, minimizing interfering reactions. DMSO in a PCR reaction is applicable for supercoiled plasmids (to relax before amplification) or DNA templates with high GC-content (to decrease thermostability). For example, 10% final concentration of DMSO in the PCR mixture with Phusion decreases primer annealing temperature (i.e.
|
|
The results of this procedure has many applications both medically and industrially. For example, applications of PCR including forensics, paternity testing, biodefence, cloning, mutation detection, genetic testing and DNA sequencing. Through these additional methods, hot start PCR is able to decrease the amount of non-specific amplifications which naturally occur during lower temperatures – which remains a problem for conventional PCR. These modifications work overall to ensure that specific enzymes in solution will remain inactive or are inhibited until the optimal annealing temperature is reached.
|
|
Enzyme linked antibodies: The enzyme linked antibodies inactivate the Taq DNA polymerase. The antibodies link and bind to the polymerase, preventing early DNA amplification which could occur at lower temperatures. Once the optimal annealing temperature is met, the antibodies will begin to degrade and dissociate, releasing the Taq DNA polymerase into the reaction and allowing the amplification process to start. Wax beads: A physical barrier is created between Taq DNA polymerase and the remainder of the PCR components by the wax beads which are temperature dependent.
|
|
A current model of meiotic recombination, initiated by a double-strand break or gap, followed by pairing with an homologous chromosome and strand invasion to initiate the recombinational repair process. Repair of the gap can lead to crossover (CO) or non-crossover (NCO) of the flanking regions. CO recombination is thought to occur by the Double Holliday Junction (DHJ) model, illustrated on the right, above. NCO recombinants are thought to occur primarily by the Synthesis Dependent Strand Annealing (SDSA) model, illustrated on the left, above.
|
|
Below the transition temperature range, the glassy structure does not relax in accordance with the cooling rate used. The expansion coefficient for the glassy state is roughly equivalent to that of the crystalline solid. If slower cooling rates are used, the increased time for structural relaxation (or intermolecular rearrangement) to occur may result in a higher density glass product. Similarly, by annealing (and thus allowing for slow structural relaxation) the glass structure in time approaches an equilibrium density corresponding to the supercooled liquid at this same temperature.
|
|
Under standard conditions, LuTaO4 has a monoclinic (labeled as M'; Pearson symbol mP12, Space group = P2/a, No 13) fergusonite-type crystal structure. This can be changed to an I2/a (M) structure by annealing at 1600 °C. Both structures are stable under standard conditions. In the M' structure, the lutetium atom is 8-fold coordinated with oxygen and forms a distorted antiprism with a C2 site symmetry. The structure of lutetium tantalate is identical to that of yttrium tantalate (YTaO4) and gadolinium tantalate (GdTaO4).
|
|
There have been several major accidents in graphite moderated reactors, with the Windscale fire and the Chernobyl disaster probably the best known. In the Windscale fire, an untested annealing process for the graphite was used, and that contributed to the accident – however it was the uranium fuel rather than the graphite in the reactor that caught fire. The only graphite moderator damage was found to be localized around burning fuel elements. In the Chernobyl disaster the graphite was a contributing factor to the cause of the accident.
|
|
1079-1081, 2014 is a planar double-diffused MOSFET (metal–oxide–semiconductor field-effect transistor) used in amplifiers, including microwave power amplifiers, RF power amplifiers and audio power amplifiers. These transistors are often fabricated on p/p+ silicon epitaxial layers. The fabrication of LDMOS devices mostly involves various ion- implantation and subsequent annealing cycles. As an example, The drift region of this power MOSFET is fabricated using up to three ion implantation sequences in order to achieve the appropriate doping profile needed to withstand high electric fields.
|
|
A current model of meiotic recombination, initiated by a double-strand break or gap, followed by pairing with an homologous chromosome and strand invasion to initiate the recombinational repair process. Repair of the gap can lead to crossover (CO) or non-crossover (NCO) of the flanking regions. CO recombination is thought to occur by the Double Holliday Junction (DHJ) model, illustrated on the right, above. NCO recombinants are thought to occur primarily by the Synthesis Dependent Strand Annealing (SDSA) model, illustrated on the left, above.
|
|
Researchers at Google, LANL, USC, Texas A&M;, and D-Wave are working hard to find such problem classes. In December 2015, Google announced that the D-Wave 2X outperforms both simulated annealing and Quantum Monte Carlo by up to a factor of 100,000,000 on a set of hard optimization problems. D-Wave's architecture differs from traditional quantum computers. It is not known to be polynomially equivalent to a universal quantum computer and, in particular, cannot execute Shor's algorithm because Shor's algorithm is not a hillclimbing process.
|
|
Induction heating is often used in the heat treatment of metal items. The most common applications are induction hardening of steel parts, induction soldering/brazing as a means of joining metal components and induction annealing to selectively soften an area of a steel part. Induction heating can produce high-power densities which allow short interaction times to reach the required temperature. This gives tight control of the heating pattern with the pattern following the applied magnetic field quite closely and allows reduced thermal distortion and damage.
|
|
The process can be performed at room temperature or at warm conditions. In warm roll bonding, heat is applied to pre-heat the sheets just before rolling, in order to increase their ductility and improve the strength of the weld. The strength of the rolled bonds depends on the main process parameters, including the rolling conditions (entry temperature of the sheets, amount of thickness reduction, rolling speed, etc.), the pre-rolling treatment conditions (annealing temperature and time, surface preparation techniques, etc.) and the post-rolling heat treatments.
|
|
A current model of meiotic recombination, initiated by a double-strand break or gap, followed by pairing with a homologous chromosome and strand invasion to initiate the recombinational repair process. Repair of the gap can lead to crossover (CO) or non-crossover (NCO) of the flanking regions. CO recombination is thought to occur by the Double Holliday Junction (DHJ) model, illustrated on the right, above. NCO recombinants are thought to occur primarily by the Synthesis Dependent Strand Annealing (SDSA) model, illustrated on the left, above.
|
|
The process then continues as before, with the parison being transferred to the final-shape mould, and the glass being blown out into the mould. The container is then picked up from the mould by the "take-out" mechanism, and held over the "deadplate", where air cooling helps cool down the still-soft glass. Finally, the bottles are swept onto a conveyor by the "push out paddles" that have air pockets to keep the bottles standing after landing on the "deadplate"; they're now ready for annealing.
|
|
Titanium alloys are heat treated for a number of reasons, the main ones being to increase strength by solution treatment and aging as well as to optimize special properties, such as fracture toughness, fatigue strength and high temperature creep strength. Alpha and near-alpha alloys cannot be dramatically changed by heat treatment. Stress relief and annealing are the processes that can be employed for this class of titanium alloys. The heat treatment cycles for beta alloys differ significantly from those for the alpha and alpha-beta alloys.
|
|
Zirconium hydrides form upon interaction of the metal with hydrogen gas. Whereas this reaction occurs even at room temperature, homogeneous bulk hydrogenation is usually achieved by annealing at temperatures of 400–600 °C for a period between several hours and a few weeks. At room temperature, zirconium hydrides quickly oxidize in air, and even in high vacuum. The formed nanometer-thin layer of oxide stops further oxygen diffusion into the material, and thus the change in composition due to oxidation can usually be neglected.
|
|
"Sixteenth Century Glass-making in Yorkshire". Post-Medieval Archaeology 6, 107-159 The Hutton furnace had two wings added in the northeast and southeast corners of the original rectangular melting furnace. A smaller nearby furnace was abandoned around the same time as the addition of the wings, suggesting that they provided an area for either annealing or pre- heating pots. Rosedale and Vann Copse were constructed in similar styles but with four wings, one in each corner, which were built integral to the original furnace.
|
|
The plasma ignites in the RIE-reactor (shown in figure "Scheme of a plasma reactor for low pressure plasma activated bonding"). The maximal bond strength is achieved with nitrogen and oxygen as process gases and is sufficiently high with a homogeneous dispersion over the wafers after annealing at 250 °C. The bond energy is characterized > 200 % of non-activated reference wafer annealed at the same temperature. The surface activated wafer pair has 15% less bond energy compared to a high temperature bonded wafer pair.
|
|
A current model of meiotic recombination, initiated by a double-strand break or gap, followed by pairing with an homologous chromosome and strand invasion to initiate the recombinational repair process. Repair of the gap can lead to crossover (CO) or non-crossover (NCO) of the flanking regions. CO recombination is thought to occur by the Double Holliday Junction (DHJ) model, illustrated on the right, above. NCO recombinants are thought to occur primarily by the Synthesis Dependent Strand Annealing (SDSA) model, illustrated on the left, above.
|
|
During these years he also worked as a system architect for Semanticedge, as a C+ developer for the European Central Bank and as a consultant and software analyst for various private companies. It was afterwards that his career path turned more into Physics. In 2004 he was awarded with a LaCaixa fellowship to study in the University of New Mexico. He studied a Master's degree in Physics in the Autonomous University of Barcelona in 2008 and he published some of his first research focusing on quantum annealing.
|
|
A current model of meiotic recombination, initiated by a double-strand break or gap, followed by pairing with an homologous chromosome and strand invasion to initiate the recombinational repair process. Repair of the gap can lead to crossover (CO) or non-crossover (NCO) of the flanking regions. CO recombination is thought to occur by the Double Holliday Junction (DHJ) model, illustrated on the right, above. NCO recombinants are thought to occur primarily by the Synthesis Dependent Strand Annealing (SDSA) model, illustrated on the left, above.
|
|
Scott Kirkpatrick is a computer scientist, and professor in the School of Engineering and Computer Science at the Hebrew University, Jerusalem. He has over 75,000 citations in the fields of: information appliances design, statistical physics, and distributed computing. He initially worked at IBM's Thomas J. Watson Research Center with Daniel Gelatt and Mario Cecchi researching computer design optimization. They argued for "simulated annealing" via the Metropolis–Hastings algorithm, whereas one can obtain iterative improvement to a fast cooling process by "defining appropriate temperatures and energies".
|
|
A current model of meiotic recombination, initiated by a double-strand break or gap, followed by pairing with an homologous chromosome and strand invasion to initiate the recombinational repair process. Repair of the gap can lead to crossover (CO) or non-crossover (NCO) of the flanking regions. CO recombination is thought to occur by the Double Holliday Junction (DHJ) model, illustrated on the right, above. NCO recombinants are thought to occur primarily by the Synthesis Dependent Strand Annealing (SDSA) model, illustrated on the left, above.
|
|
There are three modes of formation of twinned crystals. Growth twins are the result of an interruption or change in the lattice during formation or growth due to a possible deformation from a larger substituting ion. Annealing or transformation twins are the result of a change in crystal system during cooling as one form becomes unstable and the crystal structure must re-organize or transform into another more stable form. Deformation or gliding twins are the result of stress on the crystal after the crystal has formed.
|
|
A current model of meiotic recombination, initiated by a double-strand break or gap, followed by pairing with an homologous chromosome and strand invasion to initiate the recombinational repair process. Repair of the gap can lead to crossover (CO) or non-crossover (NCO) of the flanking regions. CO recombination is thought to occur by the Double Holliday Junction (DHJ) model, illustrated on the right, above. NCO recombinants are thought to occur primarily by the Synthesis Dependent Strand Annealing (SDSA) model, illustrated on the left, above.
|
|
While amorphous silicon lacks crystal structure, polycrystalline silicon consists of various crystallites or grains, each of which has an organized lattice. XeCl Excimer-Laser Annealing (ELA) is the first key method to produce p-Si by melting a-Si material through laser irradiation. The counterpart of a-Si, polycrystalline silicon, which can be synthesized from amorphous silicon by certain procedures, has several advantages over widely used a-Si TFT: # High electron mobility rate; # High resolution and aperture ratio; # Available for high integration of circuits.Kuo, Yue.
|
|
CDC films obtained by vacuum annealing (ESK) or chlorine treatment of SiC ceramics yield a low friction coefficient. The friction coefficient of SiC, which is widely used in tribological applications for its high mechanical strength and hardness, can therefore decrease from ~0.7 to ~0.2 or less under dry conditions. It’s important to mention that graphite cannot operate in dry environments. The porous 3-dimensional network of CDC allows for high ductility and an increased mechanical strength, minimizing fracture of the film under an applied force.
|
|
By controlling the amount of martensite in the steel, as well as the degree of temper, the strength level can be controlled. Depending on processing and chemistry, the strength level can range from 350 to 960 MPa. TRIP steels also use C and Mn, along with heat treatment, in order to retain small amounts of austenite and bainite in a ferrite matrix. Thermal processing for TRIP steels again involves annealing the steel in the a + g region for a period of time sufficient to allow C and Mn to diffuse into austenite.
|
|
Modern electron-beam welders are usually designed with a computer-controlled deflection system that can traverse the beam rapidly and accurately over a selected area of the work piece. Thanks to the rapid heating, only a thin surface layer of the material is heated. Applications include hardening, annealing, tempering, texturing, and polishing (with argon gas present). If the electron beam is used to cut a shallow trough in the surface, repeatedly moving it horizontally along the trough at high speeds creates a small pile of ejected melted metal.
|
|
The laser fluence must be carefully controlled in order to induce crystallization without causing widespread melting. Crystallization of the film occurs as a very small portion of the silicon film is melted and allowed to cool. Ideally, the laser should melt the silicon film through its entire thickness, but not damage the substrate. Toward this end, a layer of silicon dioxide is sometimes added to act as a thermal barrier.. This allows the use of substrates that cannot be exposed to the high temperatures of standard annealing, polymers for instance.
|
|
After separation, it is treated with hot concentrated sulfuric acid to produce water-soluble sulfates of rare earths. The acidic filtrates are partially neutralised with sodium hydroxide to pH 3–4, during which thorium precipitates as a hydroxide and is removed. The solution is treated with ammonium oxalate to convert rare earths to their insoluble oxalates, the oxalates are converted to oxides by annealing, and the oxides are dissolved in nitric acid. This last step excludes one of the main components, cerium, whose oxide is insoluble in HNO3.
|
|
The D-Wave One is a device made by a Canadian company D-Wave Systems which describes it as doing quantum annealing. In 2011, Lockheed-Martin purchased one for about US$10 million; in May 2013, Google purchased a D-Wave Two with 512 qubits. As of now, the question of whether the D-Wave processors offer a speedup over a classical processor is still unanswered. Tests performed by researchers at Quantum Artificial Intelligence Lab (NASA), USC, ETH Zurich, and Google show that as of now, there is no evidence of a quantum advantage.
|
|
PET. Photonic curing is the high-temperature thermal processing of a thin film using pulsed light from a flashlamp.K. A. Schroder, Technical Proceedings of the 2011 NSTI Nanotechnology Conference and Trade Show, 2, 220-223, 2011. When this transient processing is done on a low-temperature substrate such as plastic or paper, it is possible to attain a significantly higher temperature than the substrate can ordinarily withstand under an equilibrium heating source such as an oven. Since the rate of most thermal curing processes (drying, sintering, reacting, annealing, etc.) generally increase exponentially with temperature (i.e.
|
|
It allows for quick and efficient manipulations of a genome, all happening in a machine small enough to put on top of a small kitchen table. Those mutations combine with the variation that naturally occurs during cell mitosis creating billions of cellular mutations. Chemically combined, synthetic single-stranded DNA (ssDNA) and a pool of oligionucleotides are introduced at targeted areas of the cell thereby creating genetic modifications. The cyclical process involves transformation of ssDNA (by electroporation) followed by outgrowth, during which bacteriophage homologous recombination proteins mediate annealing of ssDNAs to their genomic targets.
|
|
Therefore, radiation detectors made of Czochralski- and magnetic Czochralski-silicon are considered to be promising candidates for many future high-energy physics experiments.CERN RD50 Status Report 2004, CERN-LHCC-2004-031 and LHCC-RD-005 and cited literature therein It has also been shown that the presence of oxygen in silicon increases impurity trapping during post-implantation annealing processes. However, oxygen impurities can react with boron in an illuminated environment, such as that experienced by solar cells. This results in the formation of an electrically active boron–oxygen complex that detracts from cell performance.
|
|
Synthetic diamonds of various colors grown by the high-pressure high-temperature technique, the diamond size is ~2 mm Pure diamonds, before and after irradiation and annealing. Clockwise from left bottom: 1) initial (2×2 mm); 2–4) irradiated by different doses of 2 MeV electrons; 5–6) irradiated by different doses and annealed at 800 °C. Diamonds occur in various colors: black, brown, yellow, gray, white, blue, orange, purple to pink and red. Colored diamonds contain crystallographic defects, including substitutional impurities and structural defects, that cause the coloration.
|
|
The fully reduced compound can be prepared by dissolving stoichiometric amounts of sodium acetate and cobalt tartrate in ethanol with a gelling agent, drying and calcinating the resulting gel, and annealing it at 650 °C.Nur Khairani Samin, Roshidah Rusdi, Norashikin Kamarudin, and Norlida Kamarulzaman (2012), "Synthesis and Battery Studies of Sodium Cobalt Oxides, ". Advanced Materials Research, volume 545, pages 185-189. The compound (or ) can be obtained in the form of platelets up to 6 mm wide from metallic cobalt powder, by treatment with molten sodium chloride and sodium hydroxide at 550 °C.
|
|
The flashtubes used on the National Ignition Facility laser were some of the largest in commercial production, operating at 30 kJ input energy per pulse. A flashtube (center) with a length of , ( arc length), for substrate annealing. As the duration of the flash that is emitted by a xenon flashtube can be accurately controlled, and due to the high intensity of the light, xenon flashtubes are commonly used as photographic strobe lights. Xenon flashtubes are also used in very high- speed or "stop-motion" photography, which was pioneered by Harold Edgerton in the 1930s.
|
|
At low F_v/r the grain size is determined by the number of nuclei, and so initially may be very small. However the grains are unstable with respect to grain growth and so will grow during annealing until the particles exert sufficient pinning pressure to halt them. At moderate F_v/r the grain size is still determined by the number of nuclei but now the grains are stable with respect to normal growth (while abnormal growth is still possible). At high F_v/r the unrecrystallized deformed structure is stable and recrystallization is suppressed.
|
|
The active chaperonin role is in turn involved with specific chaperonin–substrate interactions that may be coupled to conformational rearrangements of the chaperonin. Probably the most popular model of the chaperonin active role is the iterative annealing mechanism (IAM), which focus on the effect of iterative, and hydrophobic in nature, binding of the protein substrate to the chaperonin. According to computational simulation studies, the IAM leads to more productive folding by unfolding the substrate from misfolded conformations or by prevention from protein misfolding through changing the folding pathway.
|
|
Malleable iron also exhibits better fracture toughness properties in low temperature environments than other nodular irons, due to its lower silicon content. The ductile to brittle transition temperature is lower than many other ductile iron alloys. In order to properly form the spherical-shaped nodules of graphite (called temper graphite nodules or temper carbon nodules) in the annealing process, care must be taken to ensure that the iron casting will solidify with an entirely white iron cross section. Thicker sections of a casting will cool slowly, allowing some primary graphite to form.
|
|
The details of the process depend on the type of metal and the precise alloy involved. In any case the result is a more ductile material but a lower yield strength and a lower tensile strength. This process is also called LP annealing for lamellar pearlite in the steel industry as opposed to a process anneal, which does not specify a microstructure and only has the goal of softening the material. Often the material to be machined is annealed, and then subject to further heat treatment to achieve the final desired properties.
|
|
In early 2007, Intel announced the deployment of hafnium-based high-k dielectrics in conjunction with a metallic gate for components built on 45 nanometer technologies, and has shipped it in the 2007 processor series codenamed Penryn. At the same time, IBM announced plans to transition to high-k materials, also hafnium- based, for some products in 2008. While not identified, the most likely dielectric used in such applications are some form of nitrided hafnium silicates (HfSiON). HfO2 and HfSiO are susceptible to crystallization during dopant activation annealing.
|
|
In metallic crystals, this is a reversible process and is usually carried out on a microscopic scale by defects called dislocations, which are created by fluctuations in local stress fields within the material culminating in a lattice rearrangement as the dislocations propagate through the lattice. At normal temperatures the dislocations are not annihilated by annealing. Instead, the dislocations accumulate, interact with one another, and serve as pinning points or obstacles that significantly impede their motion. This leads to an increase in the yield strength of the material and a subsequent decrease in ductility.
|
|
The two most common irradiation methods are neutron and electron bombardment. The former treatment produces a green to black color that penetrates the whole stone, while the latter treatment produces a blue, blue-green, or green color that only penetrates about 1 mm deep. Annealing of these stones (from 500–900 °C for neutron-bombarded stones and from 500–1200 °C for electron-bombarded stones) produces orange, yellow, brown, or pink. Blue to blue-green stones that are not annealed are separated from natural stones in the same manner as gamma ray-treated stones.
|
|
The material properties of the metal interconnects have a strong influence on the life span. The characteristics are predominantly the composition of the metal alloy and the dimensions of the conductor. The shape of the conductor, the crystallographic orientation of the grains in the metal, procedures for the layer deposition, heat treatment or annealing, characteristics of the passivation and the interface to other materials also affect the durability of the interconnects. There are also grave differences with time dependent current: direct current or different alternating current waveforms cause different effects.
|
|
Nakamura managed to develop a thermal annealing method which was much more suitable for mass production. In addition, he and his co- workers worked out the physics and pointed out the culprit was hydrogen, which passivated acceptors in GaN. At the time, many considered creating a GaN LED too difficult to produce; therefore Nakamura was fortunate that the founder of Nichia, Nobuo Ogawa (1912–2002), was initially willing to support his GaN project. However the company eventually ordered him to suspend work on GaN, claiming it was consuming too much time and money.
|
|
These qualities include such things as the hardness, quenching behaviour, need for annealing, tempering behaviour, yield strength, and tensile strength of the resulting iron-hydrogen alloy. The retention of iron hydride's strength compared to pure iron is possible only by maintaining iron's ductility. At ordinary pressure, iron can incorporate a small amount of hydrogen into its crystal structure, and at extreme temperatures and pressures, such as might be found in the Earth's core, larger amounts of hydrogen can be incorporated. These substances are the subject of study in industrial metallurgy and planetary geology.
|
|
In this method, a reducing agent (such glycine, citric acid, urea, etc) and an oxidizing agent (nitrate ions, nitric acid, etc) are used to generate the reduction-oxidation (RedOx) reaction. The appearance of the flame, and consequently the temperature of the mixture, depends on the oxidizing/reducing agents ratio used. Annealing up to 600 °C is sometimes needed to decompose the bismuth oxo-nitrates generated as intermediates. Since the content of Fe cations in this semiconductor material, Mӧssbauer spectroscopy is a proper technique to detect the presence of a paramagnetic component in the phase.
|
|
Immediately before the outbreak of the First World War in 1914, Curran's supplied several annealing furnaces to the Royal Arsenal in Woolwich, and had built a major munitions factory in Ward End, Birmingham. In 1915 Curran's converted a building next to their iron foundry into a plant for manufacturing shell casings. Production of brass howitzer shell casings started in 1916, continuing until the end of the war with over seven million shell casings produced. After the First World War the business diversified and it products included enamelled metalware, including cups and plates.
|
|
Wojciech Rychlik, William J. Spencer, and Robert E. Rhoads (1990) Optimization of the Annealing Temperature for DNA Amplification in Vitro; Nucleic Acids Res. 18, 6409-6412. and consecutive upgrades in the 1990s and 2000s, all have been cited together over 600 times in scientific journals and over 500 times in patents (according to Scopus). The program is a comprehensive real time PCR primer and probe search and analysis tool, and also does other tasks such as siRNA and molecular beacon searches, open reading frame and restriction enzyme analysis etc.
|
|
Secondary structure: Certain secondary structure may impede the functions of the primers. For example, oligonucleotides with a hairpin structure cannot act efficiently as a primer. However, after heating the reaction mix to the annealing temperature the primer will undergo a conformation change allowing the primer to form a linear structure instead, which enables the primer to attach to the target segment and begin PCR. Photochemically removable cages: A caging group which is a protecting group that is photochemically removable, such as caged thymidine phosphoramidites, is incorporated into a oligonucleotide primer.
|
|
Oxygen is extremely detrimental to the reaction, as it will bind preferably to Pt, limiting the sites available for Pt-Si bonding and preventing the silicide formation. A partial pressure of O2 as low at 10−7 has been found to be sufficient to slow the formation of the silicide. To avoid this issue inert ambients are used, as well as small annealing chambers to minimize amount of potential contamination. The cleanliness of the metal film is also extremely important, and unclean conditions result in poor PtSi synthesis.
|
|
In metal processing, a reducing atmosphere is used in annealing ovens for relaxation of metal stresses without corroding the metal. A non oxidizing gas, usually nitrogen or argon, is typically used as a carrier gas so that diluted amounts of reducing gases may be used. Typically, this is achieved through using the combustion products of fuels and tailoring the ratio of CO:CO2. However, other common reducing atmospheres in the metal processing industries consist of dissociated ammonia, vacuum, and/or direct mixing of appropriately pure gases of N2, Ar, and H2.
|
|
After strand invasion, the further sequence of events may follow either of two main pathways leading to a crossover (CO) or a non-crossover (NCO) recombinant (see Genetic recombination and Homologous recombination). The pathway leading to a NCO is referred to as synthesis dependent strand annealing (SDSA). In the plant Arabidopsis thaliana FANCM helicase antagonizes the formation of CO recombinants during meiosis, thus favoring NCO recombinants. The FANCM helicase is required for genome stability in humans and yeast, and is a major factor limiting meiotic CO formation in A. thaliana.
|
|
Extensive facilities are also available for many types of ensemble calculations where the experimental data cannot be accounted for by a unique structure. Many of the structure calculation protocols involve the use of simulated annealing designed to overcome local minima on the path of the global minimum region of the target function. These calculations can be carried out using any combination of Cartesian, torsion angle and rigid body dynamics and minimization. Currently Xplor-NIH is the most versatile, comprehensive and widely used structure determination/refinement package in NMR structure determination.
|
|
Before the Monte Carlo method was developed, simulations tested a previously understood deterministic problem, and statistical sampling was used to estimate uncertainties in the simulations. Monte Carlo simulations invert this approach, solving deterministic problems using probabilistic metaheuristics (see simulated annealing). An early variant of the Monte Carlo method was devised to solve the Buffon's needle problem, in which can be estimated by dropping needles on a floor made of parallel equidistant strips. In the 1930s, Enrico Fermi first experimented with the Monte Carlo method while studying neutron diffusion, but he did not publish this work.
|
|
A commonly used method for selecting a primer site is BLAST search, whereby all the possible regions to which a primer may bind can be seen. Both the nucleotide sequence as well as the primer itself can be BLAST searched. The free NCBI tool Primer-BLAST integrates primer design and BLAST search into one application,Primer-BLAST as do commercial software products such as ePrime and Beacon Designer. Computer simulations of theoretical PCR results (Electronic PCR) may be performed to assist in primer design by giving melting and annealing temperatures, etc.
|
|
Without this percolating network, charges might be trapped in a donor or acceptor rich domain and undergo recombination. Bulk heterojunctions have an advantage over layered photoactive structures because they can be made thick enough for effective photon absorption without the difficult processing involved in orienting a layered structure while retaining similar level of performances. Bulk heterojunctions are most commonly created by forming a solution containing the two components, casting (e.g. drop casting and spin coating) and then allowing the two phases to separate, usually with the assistance of an annealing step.
|
|
Further investigation revealed that weak acid has the ability to deintercalate the excess Fe from the interlayer sites. Therefore, weak acid annealing suppresses the antiferromagnetic correlation by deintercalating the excess Fe and, hence superconductivity is achieved. There is an empirical correlation of the transition temperature with electronic band structure: the Tc maximum is observed when some of the Fermi surface stays in proximity to Lifshitz topological transition. Similar correlation has been later reported for high-Tc cuprates that indicates possible similarity of the superconductivity mechanisms in these two families of high temperature superconductors.
|
|
A diagram of the meiotic phases A current model of meiotic recombination, initiated by a double-strand break or gap, followed by pairing with an homologous chromosome and strand invasion to initiate the recombinational repair process. Repair of the gap can lead to crossover (CO) or non-crossover (NCO) of the flanking regions. CO recombination is thought to occur by the Double Holliday Junction (DHJ) model, illustrated on the right, above. NCO recombinants are thought to occur primarily by the Synthesis Dependent Strand Annealing (SDSA) model, illustrated on the left, above.
|
|
Above 800 °C native oxide gets viscous and starts to flow at the interface, which increases the area of contacted surfaces. So, the diffusion of trapped hydrogen molecules along the interface is enhanced and interface voids may reduce in size or disappear at all. The annealing process is finished by the cooling of the wafer stack. The interface energy increases to more than 2 at 800 °C with a native oxide layer or at 1000 °C if the wafers are covered by thermal oxide (compare diagram of surface energy).
|
|
Titanium nitride (TiN) coated punches using cathodic arc deposition technique The most common methods of TiN thin film creation are physical vapor deposition (PVD, usually sputter deposition, cathodic arc deposition or electron beam heating) and chemical vapor deposition (CVD). In both methods, pure titanium is sublimed and reacted with nitrogen in a high-energy, vacuum environment. TiN film may also be produced on Ti workpieces by reactive growth (for example, annealing) in a nitrogen atmosphere. PVD is preferred for steel parts because the deposition temperatures exceeds the austenitizing temperature of steel.
|
|
Another classification dimension is single solution vs population-based searches. Single solution approaches focus on modifying and improving a single candidate solution; single solution metaheuristics include simulated annealing, iterated local search, variable neighborhood search, and guided local search. Population-based approaches maintain and improve multiple candidate solutions, often using population characteristics to guide the search; population based metaheuristics include evolutionary computation, genetic algorithms, and particle swarm optimization. Another category of metaheuristics is Swarm intelligence which is a collective behavior of decentralized, self-organized agents in a population or swarm.
|
|
E-glass does not actually melt, but softens instead, the softening point being "the temperature at which a 0.55–0.77 mm diameter fiber 235 mm long, elongates under its own weight at 1 mm/min when suspended vertically and heated at the rate of 5 °C per minute". The strain point is reached when the glass has a viscosity of 1014.5 poise. The annealing point, which is the temperature where the internal stresses are reduced to an acceptable commercial limit in 15 minutes, is marked by a viscosity of 1013 poise.
|
|
Five separate buildings, each one story high, would be constructed to house a blacksmith shop, boiler, engine rooms and rooms for annealing and smelting silver and gold. They would be constructed of brick and granite trim, have stone floor and roofs of tin, making them absolutely fireproof. Steam would be used for heating and gas for lighting, which would be manufactured on the premises. A vault 10 x 13 feet, made of 1-1/2-foot granite blocks, would be installed in the main building, and a high fence would surround the entire place.”.
|
|
Since then, increasingly robust algorithms have been developed, and existing computational algorithms (such as Simulated annealing) have been adapted to the labeling problem.Introduction to automatic label placement, IBM ILOG JViews Enterprise V8.7 Help. Accessed 18 September 2012 Today, automated label placement tools are widespread, and is found in software as varied as GI, batch map renderers such as Mapnik, and javascript mapping libraries. That said, because map labelling involves subjective judgments as well as rules or guidelines, most algorithms produce rules that are sub-optimal, especially in complex maps.
|
|
The simple relationship between amino acid sequence and DNA recognition of the TALE binding domain allows for the efficient engineering of proteins. In this case, artificial gene synthesis is problematic because of improper annealing of the repetitive sequence found in the TALE binding domain. One solution to this is to use a publicly available software program (DNAWorks) to calculate oligonucleotides suitable for assembly in a two step PCR oligonucleotide assembly followed by whole gene amplification. A number of modular assembly schemes for generating engineered TALE constructs have also been reported.
|
|
Stellite is a family of completely non-magnetic and corrosion-resistant cobalt alloys of various compositions that have been optimised for different uses. The alloy currently most suited for cutting tools, for example, is Stellite 100, because this alloy is quite hard, maintains a good cutting edge at high temperature, and resists hardening and annealing. Other alloys are formulated to maximize combinations of wear resistance, corrosion resistance, or ability to withstand extreme temperatures. Stellite alloys display outstanding hardness and toughness, and are also usually very resistant to corrosion.
|
|
This is the optimized probe length as it minimizes the melting temperature variation among different probes during probe-target hybridization. After amplifying one DNA oligoprobe of interest, it can be used to create 100 different probes on 100 different sets of microspheres, each with the capability of capturing 100 potential targets (if using a 100-plex array). Similarly, target DNA samples are usually PCR amplified and labeled. Hybridization between the capture probe and the target DNA is achieved by melting and annealing complementary target DNA sequences to their capture probes located on the microspheres.
|
|
Glass comprising multiple layers of clear and (usually) red glass was known to exist in the 12th and 13th centuries. The manufacturing process is not known.Davison 2003, 131 Flashing was developed in the 15th century, and refers to the superimposition of a thin layer of coloured glass onto another coloured or uncoloured glass sheet. The procedure may have involved dipping a small sphere of molten glass into a molten uncoloured glass and blowing this into a cylinder form (the cylinder blown sheet process) which was then cut into sections and flattened in an annealing oven.
|
|
The paint applied to glass was a type of enamel, usually dark brown or black, formed from a mixture of: ground copper or iron oxide; powdered glass; wine, urine or vinegar; and gum arabic.Marks 2001, 273 other recipes could include sugar, treacle or vegetable oil.Davison 2003, 132 This ‘paint’ was applied in a series of washes, with fine details added last. Both the external and internal faces of the glass could be painted, adding depth to the overall composition. The enamel was fixed by ‘firing’ the glass in an annealing oven.
|
|
To address these new process control requirements, in 2007, Xitronix Corporation introduced a photo-reflectance system to the semiconductor process control market. Like the Therma-Probe, the Xitronix metrology system utilized a fixed wavelength probe beam generated by a laser. However, the probe beam of the Xitronix system had a wavelength of approximately 375 nanometers, near the first major interband transition in silicon. At this wavelength the electro- modulation signal is dominant, which enabled the Xitronix system to precisely measure active doping concentration in diffusion-less annealing processes.
|
|
Multiplex polymerase chain reaction (Multiplex PCR) refers to the use of polymerase chain reaction to amplify several different DNA sequences simultaneously (as if performing many separate PCR reactions all together in one reaction). This process amplifies DNA in samples using multiple primers and a temperature-mediated DNA polymerase in a thermal cycler. The primer design for all primers pairs has to be optimized so that all primer pairs can work at the same annealing temperature during PCR. Multiplex-PCR was first described in 1988 as a method to detect deletions in the dystrophin gene.
|
|
By targeting multiple sequences at once, additional information may be gained from a single test run that otherwise would require several times the reagents and more time to perform. Annealing temperatures for each of the primer sets must be optimized to work correctly within a single reaction, and amplicon sizes, i.e., their base pair length, should be different enough to form distinct bands when visualized by gel electrophoresis. Alternatively, if amplicon sizes overlap, the different amplicons may be differentiated and visualised using primers that have been dyed with different colour fluorescent dyes.
|
|
The classical chalcogenide glasses (mainly sulfur-based ones such as As-S or Ge-S) are strong glass-formers and possess glasses within large concentration regions. Glass-forming abilities decrease with increasing molar weight of constituent elements; i.e., S > Se > Te. Chalcogenide compounds such as AgInSbTe and GeSbTe are used in rewritable optical disks and phase-change memory devices. They are fragile glass-formers: by controlling heating and annealing (cooling), they can be switched between an amorphous (glassy) and a crystalline state, thereby changing their optical and electrical properties and allowing the storage of information.
|
|
Then during the annealing stage from 50-56°C primers attach to the single strands of DNA to prepare them for replication. Finally, the extending stage at 72°C the strands of DNA replicate as they would naturally as the DNA nucleotides are added reforming the double stranded helix. These stages are cycled through multiple times until the desired amount of DNA is obtained. Without the enzyme produced by T. aquaticus, Taq Polymerase, this process would not be possible as the components would normally denature at such high temperatures.
|
|
Chimeric primers: some DNA bases in the primer are replaced with RNA bases, creating a chimeric sequence. The melting temperature of a chimeric sequence with another chimeric sequence is lower than that of chimeric sequence with DNA. This difference enables setting the annealing temperature such that the primer will anneal to its target sequence, but not to other chimeric primers. Blocked-cleavable primers: a method known as RNase H-dependent PCR (rhPCR), utilizes a thermostable RNase HII to remove a blocking group from the PCR primers at high temperature.
|
|
Labino called this particular vase "Break-Through Gold Veilings" from the Emergence Series. This vase is from the Smithsonian Institution's Renwick Gallery 1980 exhibit of Dominick Labino, along with other leaders of the Studio Art Glass Movement in the U.S. This vase is in a private collection in New York City. In 1963 Labino set up his own glass studio on his farm near Grand Rapids, Ohio. He designed glass-blowing and finishing tools; built his own furnaces and annealing ovens; and began freehand blowing with molten glass.
|
|
In 2014, Veeco purchased Solid State Equipment Co., expanding its portfolio of solvent-based wet etch and clean technologies for semiconductor and compound semiconductor markets. On May 26, 2017, Veeco acquired front-end semiconductor process control equipment manufacturer Ultratech to expand into the advanced packaging market. This added to the portfolio advanced packaging lithography, laser spike annealing and 3D wafer inspection technology used in high volume manufacturing of logic and memory devices. Via the Ultratech purchase, Veeco also acquired Cambridge Nanotech, a Boston-based innovator in atomic layer deposition technology.
|
|
It is used in chambers for gas hypersensitization, a process in which photographic film is heated in forming gas to drive out moisture and oxygen and to increase the base fog of the film. Hypersensitization is used particularly in deep-sky astrophotography, which deals with low-intensity incoming light, requires long exposure times, and is thus particularly sensitive to contaminants in the film. Forming gas is also used to regenerate catalysts in glove boxes and as an atmosphere for annealing processes. It can be purchased at welding supply stores.
|
|
To produce larger crystals, the product should be frozen slowly or can be cycled up and down in temperature in a process called annealing. The freezing phase is the most critical in the whole freeze-drying process, as the freezing method can impact the speed of reconstitution, duration of freeze- drying cycle, product stability, and appropriate crystallization. Amorphous materials do not have a eutectic point, but they do have a critical point, below which the product must be maintained to prevent melt-back or collapse during primary and secondary drying.
|
|
The USC-Lockheed Martin Quantum Computing Center (QCC) is a joint scientific research effort between Lockheed Martin Corporation and the University of Southern California (USC). The QCC is housed at the Information Sciences Institute (ISI), a computer science and engineering research unit of the USC Viterbi School of Engineering, and is jointly operated by ISI and Lockheed Martin. USC faculty, ISI researchers and students are performing basic and applied research into quantum computing, and are collaborating with researchers around the world. The QCC uses a D-Wave Two quantum annealing system, manufactured by D-Wave Systems, Inc.
|
|
The process of bacterial transformation also shares many similarities with chromosomal cross over, particularly in the formation of overhangs on the sides of the broken DNA strand, allowing for the annealing of a new strand. Bacterial transformation itself has been linked to DNA repair many times. The second theory comes from the idea that meiosis evolved from bacterial transformation, with the function of propagating genetic diversity. . Thus, this evidence suggests that it is a question of whether cross over is linked to DNA repair or bacterial transformation, as the two do not appear to be mutually exclusive.
|
|
Its production mechanism is generally accepted as follows: large nickel atom incorporates substitutionally, then expels a nearby carbon (creating a neighboring vacancy), and shifts in-between the two sites. Although the physical and chemical properties of cobalt and nickel are rather similar, the concentrations of isolated cobalt in diamond are much smaller than those of nickel (parts per billion range). Several defects related to isolated cobalt have been detected by electron paramagnetic resonance and photoluminescence, but their structure is yet unknown. A chromium-related optical center has been detected in diamond after ion implantation and subsequent annealing.
|
|
To overcome problems associated with oligonucleotide quality several elaborate strategies have been developed, employing either separately prepared fishing oligonucleotides, mismatch binding enzymes of the mutS family or specific endonucleases from bacteria or phages. Nevertheless, all these strategies increase time and costs for gene synthesis based on the annealing of chemically synthesized oligonucleotides. Massively parallel sequencing has also been used as a tool to screen complex oligonucleotide libraries and enable the retrieval of accurate molecules. In one approach, oligonucleotides are sequenced on the 454 pyrosequencing platform and a robotic system images and picks individual beads corresponding to accurate sequence.
|
|
This glass was produced by blowing long cylinders of glass, which were then cut along the length and then flattened onto a cast-iron table, before being annealed. Plate glass involves the glass being ladled onto a cast-iron bed, where it is rolled into a sheet with an iron roller. The sheet, still soft, is pushed into the open mouth of an annealing tunnel or temperature-controlled oven called a lehr, down which it was carried by a system of rollers.Bontemps on Glassmaking: the Guide du Verrier of Georges Bontemps, translated by Michael Cable (2008).
|
|
This application relies on good compatibility of diamond nano-particles with the living cells and on favorable properties of photoluminescence from the N-V− centers (strong intensity, easy excitation and detection, temporal stability, etc.). Compared with large single-crystal diamonds, nanodiamonds are cheap (about 1 USD per gram) and available from various suppliers. N-V− centers are produced in diamond powders with sub- micrometre particle size using the standard process of irradiation and annealing described above. Due to the relatively small size of nanodiamond, NV centers can be produced by irradiating nanodiamond of 100nm or less with medium energy H+ beam.
|
|
Furnace annealing is a process used in semiconductor device fabrication which consist of heating multiple semiconductor wafers in order to affect their electrical properties. Heat treatments are designed for different effects. Wafers can be heated in order to activate dopants, change film to film or film to wafer substrate interfaces, densify deposited films, change states of grown films, repair damage from implants, move dopants or drive dopants from one film into another or from a film into the wafer substrate. During ion implantation process, the crystal substrate is damaged due to bombardment with high energy ions.
|
|
These cascades are made energetically favorable through the formation of new base pairs, and the entropy gain from disassembly reactions. Strand displacement cascades allow isothermal operation of the assembly or computational process, in contrast to traditional nucleic acid assembly's requirement for a thermal annealing step, where the temperature is raised and then slowly lowered to ensure proper formation of the desired structure. They can also support catalytic function of the initiator species, where less than one equivalent of the initiator can cause the reaction to go to completion. Strand displacement complexes can be used to make molecular logic gates capable of complex computation.
|
|
In spite of its known drawbacks, one of the most widely used methods for community detection is modularity maximization. Modularity is a benefit function that measures the quality of a particular division of a network into communities. The modularity maximization method detects communities by searching over possible divisions of a network for one or more that have particularly high modularity. Since exhaustive search over all possible divisions is usually intractable, practical algorithms are based on approximate optimization methods such as greedy algorithms, simulated annealing, or spectral optimization, with different approaches offering different balances between speed and accuracy.
|
|
In his thesis, Boyd described the effects of reflecting radiation through samples of powdered, cold-worked and annealed beryllium with differing particle sizes. The experiment showed that beryllium crystals are "rather imperfect", that annealing caused "no appreciable change" in beryllium's lattice structure, and that the mass absorption coefficient of beryllium found in the experiment was reasonably close to the theoretical value calculated using Compton's empirical formula. Boyd was appointed as head of the Mathematics and Science Department at West Georgia College in 1933. In 1935, he joined the faculty at the Georgia Institute of Technology as an assistant professor of physics.
|
|
In the long term, the Moon will likely play an important role in supplying space-based construction facilities with raw materials. Zero gravity in space allows for the processing of materials in ways impossible or difficult on Earth, such as "foaming" metals, where a gas is injected into a molten metal, and then the metal is annealed slowly. On Earth, the gas bubbles rise and burst, but in a zero gravity environment, that does not happen. The annealing process requires large amounts of energy, as a material is kept very hot for an extended period of time.
|
|
The diesel engine of the V 300 had significant initial problems; the original crankshaft was made from ductile cast iron but was prone to cracking, particularly after the winter. The cast cranks were replaced with forged versions providing running for 20,000 hours, but initially they suffered from low surface hardness; this problem was solved by nitriding the surface, and by locally heating the surface with a CO2 laser (see annealing). The engine drives an AC generator whose current is rectified by six-way rectification using 240 diodes. Traction motor power control is achieved via the engine (i. e.
|
|
There have been two major accidents in graphite-moderated reactors, the Windscale fire and the Chernobyl disaster. In the Windscale fire, an untested annealing process for the graphite was used, causing overheating in unmonitored areas of the core and leading directly to the ignition of the fire. The material that ignited was not the graphite moderator itself, but rather the canisters of metallic uranium fuel within the reactor. When the fire was extinguished, it was found that the only areas of the graphite moderator to have incurred thermal damage were those that had been close to the burning fuel canisters.
|
|
An example of annealing is described in a 2005 paper by Petta, et al., where a Bell pair of electrons is prepared in quantum dots. This procedure relies on T1 to anneal the system, and the paper focuses on measuring the T2 relaxation time of the quantum-dot system and gives an idea of the timescales involved (milliseconds), which would be a fundamental roadblock, given that then the decoherence time is shorter than the initialisation time. Alternate approaches (usually involving optical pumping) have been developed to reduce the initialisation time and improve the fidelity of the procedure.
|
|
Such deformation increases the concentration of dislocations which may subsequently form low-angle grain boundaries surrounding sub-grains. Cold working generally results in a higher yield strength as a result of the increased number of dislocations and the Hall–Petch effect of the sub-grains, and a decrease in ductility. The effects of cold working may be reversed by annealing the material at high temperatures where recovery and recrystallization reduce the dislocation density. A material's work hardenability can be predicted by analyzing a stress–strain curve, or studied in context by performing hardness tests before and after a process.
|
|
The final color is dependent on the diamond's composition, and the temperature and length of annealing. Cyclotroned diamonds have a green to blue-green color confined to the surface layer: they are later annealed to 800 °C to produce a yellow or orange color. They remain radioactive for only a few hours after treatment, and due to the directional nature of the treatment and the cut of the stones, the color is imparted in discrete zones. If the stone was cyclotroned through the pavilion (back), a characteristic "umbrella" of darker color will be seen through the crown (top) of the stone.
|
|
Coppersmith Abdón Punzo in his workshop in Santa Clara del Cobre, Mexico "Aeolus's Weathervane." Detail of a weather vane created by using a variety of metalsmithing techniques The ancient traditional tool of the smith is a forge or smithy, which is a furnace designed to allow compressed air (through a bellows) to superheat the inside, allowing for efficient melting, soldering and annealing of metals. Today, this tool is still widely used by blacksmiths as it was traditionally. The term, metalsmith, often refers to artisans and craftpersons who practice their craft in many different metals, including gold, copper and silver.
|
|
The term salicide refers to a technology used in the microelectronics industry used to form electrical contacts between the semiconductor device and the supporting interconnect structure. The salicide process involves the reaction of a metal thin film with silicon in the active regions of the device, ultimately forming a metal silicide contact through a series of annealing and/or etch processes. The term "salicide" is a compaction of the phrase self- aligned silicide. The description "self-aligned" suggests that the contact formation does not require photolithography patterning processes, as opposed to a non-aligned technology such as polycide.
|
|
If neighborhood searched is limited to just one or a very small number of changes from the current solution, then it can be difficult to escape from local minima, even with additional meta-heuristic techniques such as Simulated Annealing or Tabu search. In large neighborhood search techniques, the possible changes from one solution to its neighbor may allow tens or hundreds of values to change, and this means that the size of the neighborhood may itself be sufficient to allow the search process to avoid or escape local minima, though additional meta-heuristic techniques can still improve performance.
|
|
Preheating: The PCR machine is heated in advance whilst the components are mixed over ice and then immediately placed into the PCR machine once it reaches optimum temperature. This would eliminate the warm-up process required, reduce non-specific annealing of the primers and ensures that any miss paired primers in the mixture are separated. Freezing: Freezing acts as a form of physical separation much like the wax beads. The reaction mixture containing primers, the template strand, water and deoxyribonucleotide triphosphate (dNTP) is frozen before Taq polymerase and the remaining PCR components are added on top of the frozen mixture.
|
|
Gallium tends to segregate in plutonium, causing "coring"—gallium-rich centers of grains and gallium-poor grain boundaries. To stabilize the lattice and reverse and prevent segregation of gallium, annealing is required at the temperature just below the δ–ε phase transition, so gallium atoms can diffuse through the grains and create homogeneous structure. The time to achieve homogenization of gallium increases with increasing grain size of the alloy and decreases with increasing temperature. The structure of stabilized plutonium at room temperature is the same as unstabilized at δ-phase temperature, with the difference of gallium atoms substituting plutonium in the fcc lattice.
|
|
In contrast, qPCR records the relative fluorescence of the DNA at specific points during the amplification process, which requires stops in the experimental process. This “real-time” aspect of qPCR may theoretically affect results due to the stopping of the experiment. In practice, however, most qPCR thermal cyclers read each sample's fluorescence very quickly at the end of the annealing/extension step before proceeding to the next melting step, meaning this hypothetical concern is not actually relevant or applicable for the vast majority of researchers. qPCR is unable to distinguish differences in gene expression or copy number variations that are smaller than twofold.
|
|
The former Peck, Stow & Wilcox Factory complex was located west of the town center of Southington, and occupied most of a block bounded by Center, Water, and Mill Streets, and the railroad right-of-way now occupied by the Farmington Canal Heritage Trail. When it was described in 1989 for the National Register, its main buildings were a large forge with a sawtooth roof, and an equally large annealing building. These two were accompanied by an assortment of smaller one and two-story brick buildings. Buildings already demolished at that time included the company's original 1870 plant.
|
|
Molten glass was poured in fine streams and cooled in an annealing chamber, yielding precision suitable for art and consumer products, and glass strength suitable for architectural elements. The process allowed close control of color, transparency, thickness and texture. Changing the height and speed of the nozzle produced uniform loops, turning the printer into a "molden glass sewing machine". A set of glass vessels made with this printer went on exhibit at the Cooper Hewitt and other museums, and a 10-foot tall sculpture of light and printed glass, YET, was designed for the 2017 Milan Design Week.
|
|
300px The tunneling field is basically a kinetic energy term that does not commute with the classical potential energy part of the original glass. The whole process can be simulated in a computer using quantum Monte Carlo (or other stochastic technique), and thus obtain a heuristic algorithm for finding the ground state of the classical glass. In the case of annealing a purely mathematical objective function, one may consider the variables in the problem to be classical degrees of freedom, and the cost functions to be the potential energy function (classical Hamiltonian). Then a suitable term consisting of non-commuting variable(s) (i.e.
|
|
A new attempt to fuse the advantages of bulk silicon with those of thin-film devices is thin film polycrystalline silicon on glass. These modules are produced by depositing an antireflection coating and doped silicon onto textured glass substrates using plasma-enhanced chemical vapor deposition (PECVD). The texture in the glass enhances the efficiency of the cell by approximately 3% by reducing the amount of incident light reflecting from the solar cell and trapping light inside the solar cell. The silicon film is crystallized by an annealing step, temperatures of 400–600 Celsius, resulting in polycrystalline silicon.
|
|
These furnaces were made from stone and the crucibles from imported, highly-refractory clay. They differ in style from the Islamic furnaces of the east, and those of southern Europe, the 'beehive' style where the annealing chamber is above the main oven rather than on the same level. The furnace firing cycle would be optimised for fuel consumption, output, and humanpower, and, as the technology improved, larger glasshouses operated on an almost continuous basis. It has been estimated that a large glasshouse typically, might use 67 tonnes of wood a week operating for 40 weeks a year.
|
|
Oxy-acetylene welding was a popular welding process in previous decades. The development and advantages of arc-based welding processes have made oxy-fuel welding nearly extinct for many applications. Acetylene usage for welding has dropped significantly. On the other hand, oxy-acetylene welding equipment is quite versatile – not only because the torch is preferred for some sorts of iron or steel welding (as in certain artistic applications), but also because it lends itself easily to brazing, braze-welding, metal heating (for annealing or tempering, bending or forming), the loosening of corroded nuts and bolts, and other applications.
|
|
It is used widely in artificial intelligence, for reaching a goal state from a starting node. Different choices for next nodes and starting nodes are used in related algorithms. Although more advanced algorithms such as simulated annealing or tabu search may give better results, in some situations hill climbing works just as well. Hill climbing can often produce a better result than other algorithms when the amount of time available to perform a search is limited, such as with real-time systems, so long as a small number of increments typically converges on a good solution (the optimal solution or a close approximation).
|
|
Thus, most gene conversion events in the several different fungi studied are associated with non-crossover of outside markers. Non-crossover gene conversion events are mainly produced by Synthesis Dependent Strand Annealing (SDSA). This process involves limited informational exchange, but not physical exchange of DNA, between the two participating homologous chromosomes at the site of the conversion event, and little genetic variation is produced. Thus, explanations for the adaptive function of meiotic recombination that focus exclusively on the adaptive benefit of producing new genetic variation or physical exchange seem inadequate to explain the majority of recombination events during meiosis.
|
|
Capillary blotting system setup for the transfer of RNA from an electrophoresis gel to a blotting membrane. A nylon membrane with a positive charge is the most effective for use in northern blotting since the negatively charged nucleic acids have a high affinity for them. The transfer buffer used for the blotting usually contains formamide because it lowers the annealing temperature of the probe- RNA interaction, thus eliminating the need for high temperatures, which could cause RNA degradation. Once the RNA has been transferred to the membrane, it is immobilized through covalent linkage to the membrane by UV light or heat.
|
|
Some fiamme are formed from flattened hot, relatively low viscosity, high porosity fragments of volcanic glass or pumice. But this is not the only way they can form: they can also form when pumice lapilli are altered to clay and compact during diagenesis; and fiamme are also widely reported in viscous lavas (andesites to rhyolites) where they form by shear-induced autobrecciation of pumiceous or obsidian zones, followed by shear and annealing of the fragments. Fiamme can also result from patchy alteration and recrystalisation of volcanic rocks, or by patchy revesiculation of welded tuff matrix (especially in rheomorphic peralkaline tuffs).
|
|
The modern transistor has an internal structure that exploits complex physical mechanisms. Device design requires a detailed understanding of how device manufacturing processes such as ion implantation, impurity diffusion, oxide growth, annealing, and etching affect device behavior. Process models simulate the manufacturing steps and provide a microscopic description of device "geometry" to the device simulator. "Geometry" does not mean readily identified geometrical features such as a planar or wrap-around gate structure, or raised or recessed forms of source and drain (see Figure 1 for a memory device with some unusual modeling challenges related to charging the floating gate by an avalanche process).
|
|
Superconducting quantum computing is an implementation of a quantum computer in superconducting electronic circuits. Research in superconducting quantum computing is conducted by Google, IBM, IMEC, BBN Technologies,Colm A. Ryan, Blake R. Johnson, Diego Ristè, Brian Donovan, Thomas A. Ohki, "Hardware for Dynamic Quantum Computing", arXiv:1704.08314v1 Rigetti, and Intel. , up to nine fully controllable qubits are demonstrated in a 1D array, up to sixteen in a 2D architecture. More than two thousand superconducting qubits are in a commercial product by D-Wave Systems, however these qubits implement quantum annealing instead of a universal model of quantum computation.
|
|
A basic explanation of Simulated Annealing is that it is a lot like II, only instead of taking the greedy step each time, it will sometimes accept a step that results in an increase in cost. In theory, SA will be less likely to stop at a very local minimum, and more likely to find a more global one. A useful piece of imagery is an "M" shaped graph, representing overall cost on the Y axis. If the initial state is on the "V" shaped part of the "M", II will settle into the high valley, the local minimum.
|
|
Many of the shapes and forms that come out of foldforming resemble many things seen in nature, and utilizes laws of nature in the creation process. The most common shapes created using foldforming are flowers, leaves or horns of a ram, as these require the repeated process of folding, annealing, unfolding, and hammering of sheet metal that foldforming also involves. The process of a flower unfolding or how a leaf forms is similar between natural occurrences and foldforming. With this, artists are able to obtain a better understanding of how to incorporate nature's natural beauty into their artwork.
|
|
TALEN can be used to edit genomes by inducing double-strand breaks (DSB), which cells respond to with repair mechanisms. Non-homologous end joining (NHEJ) directly ligates DNA from either side of a double-strand break where there is very little or no sequence overlap for annealing. This repair mechanism induces errors in the genome via indels (insertion or deletion), or chromosomal rearrangement; any such errors may render the gene products coded at that location non- functional. Because this activity can vary depending on the species, cell type, target gene, and nuclease used, it should be monitored when designing new systems.
|
|
A sheathed ōdachi Ōdachi are difficult to produce because their length makes traditional heat treatment more complicated: The longer a blade is, the more difficult (and expensive) it is to heat the whole blade to a homogeneous temperature, both for annealing and to reach the hardening temperature. The quenching process then needs a bigger quenching medium because uneven quenching might lead to warping the blade. The method of polishing is also different. Because of their size, ōdachi are usually hung from the ceiling or placed in a stationary position to be polished, unlike normal swords which are moved over polishing stones.
|
|
This image shows how OE-PCR might be utilized to delete a sequence from a DNA strand To insert a mutation into a DNA sequence, a specific primer is designed. The primer may contain a single substitution or contain a new sequence at its 5' end. If a deletion is required, a sequence that is 5' of the deletion is added, because the 3' end of the primer must have complementarity to the template strand so that the primer can sufficiently anneal to the template DNA. Following annealing of the primer to the template, DNA replication proceeds to the end of the template.
|
|
Iron–platinum nanoparticles (FePt NPs) are 3D superlattices composed of an approximately equal atomic ratio of Fe and Pt. Under standard conditions, FePt NPs exist in the face-centered cubic phase but can change to a chemically ordered face-centered tetragonal phase as a result of thermal annealing. Currently there are many synthetic methods such as water-in-oil microemulsion, one-step thermal synthesis with metal precursors, and exchanged-coupled assembly for making FePt NPs.Hyie, K. M.(2010). “Synthesis of Iron-Platinum Nanoparticles in Water-in-Oil Microemulsions for High-Density Storage Media Application”. 1-9.
|
|
Carbon peapods can be naturally produced during carbon nanotube synthesis by pulsed laser vaporization. C60 fullerene impurities are formed during the annealing treatment and acid purification, and enter the nanotubes through defects or vapor-phase diffusion. Fullerenes within a nanotube are only stabilized at a diameter difference of 0.34 nm or less, and when the diameters are nearly identical, the interacting energy heightens to such a degree (comparable to 0.1 GPa) that the fullerenes become unable to be extracted from the SWNT even under high vacuum. The encapsulated fullerenes have diameters close to that of C60 and form a chain inside the tube.
|
|
APG is produced in a process similar method to Highly Oriented Pyrolytic Graphite (HOPG), where hydrocarbon gas is heated until it breaks down into carbon. Pyrolytic graphite (PG) is then grown on plates using a chemical vapor deposition (CVD) process. The PG is then annealed at high temperature to form the more planar and more uniform carbon structure of APG, described above. The primary difference between the HOPG and APG synthesis methods is that the APG annealing process does not require the use of induced stresses, resulting in a more affordable and practical bulk material for production use.
|
|
J. Biol. Chem. 276:44919–25 After DnaB translocates to the apex of each replication fork, the helicase both unwinds the parental DNA and interacts momentarily with primase.Tougu K, Marians KJ. 1996. The interaction between helicase and primase sets the replication fork clock. J. Biol. Chem. 271:21398–405 In order for DNA replication to continue, single stranded binding proteins are needed to prevent the single strands of DNA from forming secondary structures and to prevent them from re-annealing. In addition, DNA gyrase is needed to relieve the topological stress created by the action of DnaB helicase.
|
|
While working in the institute in collaboration with Leningrad’s researcher O.V. Mazurin, Yu. Belousov wrote the book The Annealing and Tempering of Glass, a popular and famous manual among engineers. This book, devoted to a new method of glass treatment, became a respected reference guide for specialists and researchers in other related industries. Based on this method, in 1988, Yu. Belousov, O.V. Mazurin and others developed USSR’s first technology of a glass dust-free method of sealing glass ampoules, which significantly decreased contamination in medicinal ampouled preparations. This invention was first introduced at one of the Soviet biopharmaceutical plants currently belonging to the Russian concern VEROPHARM.
|
|
In aluminum-induced crystallization, a thin layer of aluminum (50 nm or less) is deposited by physical vapor deposition onto the surface of the amorphous silicon. This stack of material is then annealed at a relatively low temperature between 140 °C and 200 °C in a vacuum. The aluminum that diffuses into the amorphous silicon is believed to weaken the hydrogen bonds present, allowing crystal nucleation and growth.. Experiments have shown that polycrystalline silicon with grains on the order of 0.2 – 0.3 μm can be produced at temperatures as low as 150 °C. The volume fraction of the film that is crystallized is dependent on the length of the annealing process.
|
|
Richard Feynman, the renowned Caltech theoretical physicist, worked on the T4 rII system during the summer of 1961, and his experimental results were included in a publication by Edgar et al. These authors showed that recombination frequencies between rII mutants are not strictly additive. The recombination frequency from a cross of two rII mutants (a x d) is usually less than the sum of recombination frequencies for adjacent internal sub- intervals (a x b) + (b x c) + (c x d). Although not strictly additive, a systematic relationship was observed that likely reflects the underlying molecular mechanism of recombination (see genetic recombination and synthesis dependent strand annealing).
|
|
PMMA vaporizes to gaseous compounds (including its monomers) upon laser cutting, so a very clean cut is made, and cutting is performed very easily. However, the pulsed lasercutting introduces high internal stresses along the cut edge, which on exposure to solvents produce undesirable "stress-crazing" at the cut edge and several millimetres deep. Even ammonium-based glass-cleaner and almost everything short of soap- and-water produces similar undesirable crazing, sometimes over the entire surface of the cut parts, at great distances from the stressed edge. Annealing the PMMA sheet/parts is therefore an obligatory post-processing step when intending to chemically bond lasercut parts together.
|
|
It was the third transuranium element to be discovered even though it is the fourth in the series – the lighter element americium was unknown at the time. The sample was prepared as follows: first plutonium nitrate solution was coated on a platinum foil of about 0.5 cm2 area, the solution was evaporated and the residue was converted into plutonium(IV) oxide (PuO2) by annealing. Following cyclotron irradiation of the oxide, the coating was dissolved with nitric acid and then precipitated as the hydroxide using concentrated aqueous ammonia solution. The residue was dissolved in perchloric acid, and further separation was carried out by ion exchange to yield a certain isotope of curium.
|
|
In particular, when used on a silicon wafer with a < 1 1 1 > crystal orientation, excessive alloying of aluminum (from extended high temperature processing steps) with the underlying silicon can create a short circuit between the diffused FET source or drain areas under the aluminum and across the metallurgical junction into the underlying substrate causing irreparable circuit failures. These shorts are created by pyramidal-shaped spikes of silicon-aluminum alloy pointing vertically "down" into the silicon wafer. The practical high- temperature limit for annealing aluminum on silicon is on the order of 450 °C. Polysilicon is also attractive for the easy manufacturing of self-aligned gates.
|
|
Other classes are branch migration proteins that increase the exchange rate by orders of magnitude, and site-specific recombinases. In prokaryotes, Holliday junction resolvases fall into two families, integrases and nucleases, that are each structurally similar although their sequences are not conserved. In eukaryotes, two primary models for how homologous recombination repairs double-strand breaks in DNA are the double-strand break repair (DSBR) pathway (sometimes called the double Holliday junction model) and the synthesis- dependent strand annealing (SDSA) pathway. In the case of double strand breakage, the 3' end is degraded and the longer 5' end invades the contiguous sister chromatid, forming a replication bubble.
|
|
As a rule, ohmic contacts on semiconductors form more easily when the semiconductor is highly doped nearby the junction; a high doping narrows the depletion region at the interface and allow electrons to flow in both directions easily at any bias by tunneling through the barrier. The fundamental steps in contact fabrication are semiconductor surface cleaning, contact metal deposition, patterning and annealing. Surface cleaning may be performed by sputter-etching, chemical etching, reactive gas etching or ion milling. For example, the native oxide of silicon may be removed with a hydrofluoric acid dip, while GaAs is more typically cleaned by a bromine- methanol dip.
|
|
Parallel metaheuristic is a class of techniques that are capable of reducing both the numerical effort and the run time of a metaheuristic. To this end, concepts and technologies from the field of parallelism in computer science are used to enhance and even completely modify the behavior of existing metaheuristics. Just as it exists a long list of metaheuristics like evolutionary algorithms, particle swarm, ant colony optimization, simulated annealing, etc. it also exists a large set of different techniques strongly or loosely based in these ones, whose behavior encompasses the multiple parallel execution of algorithm components that cooperate in some way to solve a problem on a given parallel hardware platform.
|
|
Normalization is an annealing process applied to ferrous alloys to give the material a uniform fine-grained structure and to avoid excess softening in steel. It involves heating the steel to 20–50 °C above its upper critical point, soaking it for a short period at that temperature and then allowing it to cool in air. Heating the steel just above its upper critical point creates austenitic grains (much smaller than the previous ferritic grains), which during cooling, form new ferritic grains with a further refined grain size. The process produces a tougher, more ductile material, and eliminates columnar grains and dendritic segregation that sometimes occurs during casting.
|
|
Pure diamonds, before and after irradiation and annealing. Numbered clockwise from left bottom: (1) 2×2 mm initial; top row (2,3,4) irradiated by different doses of 2 MeV electrons; bottom right (5,6) irradiated by different doses and annealed at 800 °C. Sir William Crookes, a gem fancier as well as a chemist and physicist, was the first to discover radiation's effects on diamond color when in 1904 he conducted a series of experiments using radium salts. Diamonds enveloped in radium salt slowly turned a dark green; this color was found to be localized in blotchy patches, and it did not penetrate past the surface of the stone.
|
|
Presently diamonds are safely irradiated in four ways: Proton and deuteron bombardment via cyclotrons; gamma ray bombardment via exposure to cobalt-60; neutron bombardment via the piles of nuclear reactors; and electron bombardment via van de Graaff generators. These high-energy particles physically alter the diamond's crystal lattice, knocking carbon atoms out of place and producing color centers. Irradiated diamonds are all some shade of green, black, or blue after treatment, but most are annealed to further modify their color into bright shades of yellow, orange, brown, or pink. The annealing process increases the mobility of individual carbon atoms, allowing some of the lattice defects created during irradiation to be corrected.
|
|
Upon heating in a vacuum, polymeric As2S3 "cracks" to give a mixture of molecular species, including molecular As4S6. As4S6 adopts the adamantane geometry, like that observed for P4O6 and As4O6. When a film of this material is exposed to an external energy source such as thermal energy (via thermal annealing ), electromagnetic radiation (i.e. UV lamps, lasers, electron beams)), As4S6 polymerizes: :2/n (As2S3)n As4S6 As2S3 characteristically dissolves upon treatment with aqueous solutions containing sulfide ions. The dissolved arsenic species is the pyramidal trianion AsS: : As2S3 \+ 6 NaSH → 2 AsS + 3 H2S As2S3 is the anhydride of the hypothetical thioarsenous acid, As(SH)3.
|
|
To ensure this very low primary current densities are used generally in the range of 10−10 – 10−9 A/cm² (primary ion dose is below 1012 \- 1013 ions/cm2). This leads to extremely small sputtering rates of fraction of a monolayer per hour and hence small secondary ion current density. Additionally, these emitted secondary ions are of low kinetic energy and emitted up to 20 nm from the impact site with surface annealing occurring in femto-seconds. These reasons make SSIMS a purely surface analysis technique causing negligible damage to the surface and with detection limit as low as 10−8 monolayer (ML) .
|
|
Very few metals react to heat treatment in the same manner, or to the same extent, that carbon steel does, and carbon-steel heat-treating behavior can vary radically depending on alloying elements. Steel can be softened to a very malleable state through annealing, or it can be hardened to a state nearly as rigid and brittle as glass by quenching. However, in its hardened state, steel is usually far too brittle, lacking the fracture toughness to be useful for most applications. Tempering is a method used to decrease the hardness, thereby increasing the ductility of the quenched steel, to impart some springiness and malleability to the metal.
|
|
Edward S. Davidson is a professor emeritus in Electrical Engineering and Computer Science at the University of Michigan, Ann Arbor. His research interests include computer architecture, pipelining theory, parallel processing, performance modeling, intelligent caches, and application tuning. In the 1970s, he developed the reservation table approach to optimum design and cyclic scheduling of pipelines, designed and implemented an eight-node symmetric multiprocessor (SMP) system in 1976, and developed a variety of systematic methods for modeling performance and enhancing systems, including early work on simulated annealing, wave pipelining, multiple instruction stream pipelines, decoupled access-execute architecture, and polycyclic scheduling (aka software pipelining). He is a Fellow of the IEEE.
|
|
Procedure of traditional polymerase chain reaction (PCR) Polymerase chain reaction (PCR) is a molecular biology technique used to amplify specific DNA segments by several orders of magnitude. The specific segments of DNA is amplified over three processes, denaturation, annealing and extension – where the DNA strands are separated by raising the temperature to the optimal from room temperature before primers bind and polymerase aligns nucleotides to the template strand. It uses DNA polymerase, which is slightly active at low temperatures. In conventional PCR, the reaction mix is completed at room temperature, and due to DNA polymerase activity, primers may form primer dimers or anneal to DNA non-specifically.
|
|
In between each hubbing, however, the die being made must be subjected to an annealing procedure to soften the steel, making it easier to force the hub's image into the die. As the die is being cold forged in the hubbing press, work hardening makes the hubbed die harder and stronger than in its original state (an advantage over engraving the die). If, when the die is subjected to another hubbing, it is not lined up exactly with the hub, the result is a secondary image, or doubling. This is called die doubling, and results in such spectacular coins as the famous 1955 doubled die cent.
|
|
Then, the remaining unbound probes are washed out, the fluorescent signal from the bound probe is measured, and the bound probe is cleaved between its fifth and sixth nucleotide. Finally the primer and probes are all reset for the next round. In the next round a new universal primer anneals the position n-1 (its 5’-end matches to the base exactly before the 3’-end of the P1) and the subsequent cycles are repeated similar to the first round. The remaining three rounds will be performed with new universal primers annealing positions n-2, n-3 and n-4 relative to the 3'-end of P1.
|
|
Sheffield developed from a small township into one of Europe's leading industrial cities. The steel was produced in specialised workshops called 'crucible furnaces', which consisted of a workshop at ground level and a subterranean cellar. The furnace buildings varied in size and architectural style, growing in size towards the latter part of the 19th century as technological developments enabled multiple pots to be "fired" at once, using gas as a heating fuel. Each workshop had a series of standard features, such as rows of melting holes, teaming pits, roof vents, rows of shelving for the crucible pots and annealing furnaces to prepare each pot before firing.
|
|
Fig 5: Highly folded heterojunction (a); heterojunction with controlled growth (b) As described above, dispersed heterojunctions of donor-acceptor organic materials have high quantum efficiencies compared to the planar hetero- junction, because in dispersed heterojunctions it is more likely for an exciton to find an interface within its diffusion length. Film morphology can also have a drastic effect on the quantum efficiency of the device. Rough surfaces and the presence of voids can increase the series resistance and also the chance of short-circuiting. Film morphology and, as a result, quantum efficiency can be improved by annealing of a device after covering it by a ~1000 Å thick metal cathode.
|
|
For a polycrystalline alloy, an established formula for the magnetostriction λ from known directional microstrain measurements is: λs = 1/5(2λ100+3λ111) Magnetostrictive alloy deformed to fracture. During subsequent hot rolling and recrystallization steps, particle strengthening occurs in which the particles introduce a “pinning” force at grain boundaries that hinders normal (stochastic) grain growth in an annealing step assisted by a atmosphere. Thus, single-crystal-like texture (~90% {011} grain coverage) is attainable, reducing the interference with magnetic domain alignment and increasing microstrain attainable for polycrystalline alloys as measured by semiconducting strain gauges. These surface textures can be visualized using electron backscatter diffraction (EBSD) or related diffraction techniques.
|
|
These interacting Markov chain Monte Carlo samplers can be interpreted as a way to run in parallel a sequence of Markov chain Monte Carlo samplers. For instance, interacting simulated annealing algorithms are based on independent Metropolis-Hastings moves interacting sequentially with a selection-resampling type mechanism. In contrast to traditional Markov chain Monte Carlo methods, the precision parameter of this class of interacting Markov chain Monte Carlo samplers is only related to the number of interacting Markov chain Monte Carlo samplers. These advanced particle methodologies belong to the class of Feynman-Kac particle models, also called Sequential Monte Carlo or particle filter methods in Bayesian inference and signal processing communities.
|
|
This boule is usually no larger than 2.5 centimetres in diameter and 10 centimetres long; it is an opaque black to begin with, requiring further annealing in an oxidizing atmosphere in order to make the crystal colourless and to relieve strain. This is done at over 1000 °C for 12 hours. Thin films of SrTiO3 can be grown epitaxially by various methods, including pulsed laser deposition, molecular beam epitaxy, RF sputtering and atomic layer deposition. As in most thin films, different growth methods can result in significantly different defect and impurity densities and crystalline quality, resulting in a large variation of the electronic and optical properties.
|
|
Currently there are nearly 1300 different protein folds known, but new folds are still being discovered every year due in significant part to the ongoing structural genomics projects. Many different algorithms have been proposed for finding the correct threading of a sequence onto a structure, though many make use of dynamic programming in some form. For full 3-D threading, the problem of identifying the best alignment is very difficult (it is an NP-hard problem for some models of threading). Researchers have made use of many combinatorial optimization methods such as Conditional random fields, simulated annealing, branch and bound and linear programming, searching to arrive at heuristic solutions.
|
|
It is strong under compression, but not under tension. Cast iron was invented in China in the 5th century BC and poured into molds to make ploughshares and pots as well as weapons and pagodas. Although steel was more desirable, cast iron was cheaper and thus was more commonly used for implements in ancient China, while wrought iron or steel was used for weapons. The Chinese developed a method of annealing cast iron by keeping hot castings in an oxidizing atmosphere for a week or longer in order to burn off some carbon near the surface in order to keep the surface layer from being too brittle.
|
|
Mammalian cells with mutant ERCC1–XPF are moderately more sensitive than normal cells to agents (such as ionizing radiation) that cause double- stranded breaks in DNA. Particular pathways of both homologous recombination repair and non-homologous end-joining rely on ERCC1-XPF function. The relevant activity of ERCC1–XPF for both types of double-strand break repair is the ability to remove non-homologous 3′ single-stranded tails from DNA ends before rejoining. This activity is needed during a single-strand annealing subpathway of homologous recombination. Trimming of 3’ single-stranded tail is also needed in a mechanistically distinct subpathway of non-homologous end-joining, dependent on the Ku proteins.
|
|
Some jacket alloys have greater tensile strength than others; and, for any given alloy and annealing process, a thicker jacket will be stronger than a thinner jacket. Energy available to expand the bullet is proportional to the square of the velocity at which the bullet strikes the target. If the bullet passes through the target, the energy represented by the square of the velocity of the departing bullet has no effect on the target. Soft point bullets may not expand if they strike a target at low velocity, or if the target does not slow the bullet enough to deform the exposed point or rupture the surrounding jacket.
|
|
In addition to masking key elements within single-stranded RNA, the formation of double-stranded RNA duplexes can also provide a substrate for the generation of endogenous siRNAs (endo-siRNAs) in Drosophila and mouse oocytes. The annealing of complementary sequences, such as antisense or repetitive regions between transcripts, forms an RNA duplex that may be processed by Dicer-2 into endo-siRNAs. Also, long ncRNAs that form extended intramolecular hairpins may be processed into siRNAs, compellingly illustrated by the esi-1 and esi-2 transcripts. Endo-siRNAs generated from these transcripts seem particularly useful in suppressing the spread of mobile transposon elements within the genome in the germline.
|
|
This shop had nine oil-fired heating furnaces, including a car bottom type annealing furnace, all with doors operated by compressed air. The shop also contained a 50-ton steam hydraulic press capable of delivering a 1,000-ton pressure, a 4,000 lb double frame steam hammer with a 2-ton capacity, a 20-ton overhead crane and 10-ton auxiliary hoist along with two 25-ton rotators, and even its own railway siding and derrick."Work at the Morse Yard", The Rudder, November 1919, pp. 520-521. Other facilities of the Morse yard around this time included a three-story machine shop, carpentry shop, pattern and joining shop, storage depots etc.
|
|
If the problem to be solved has all locally optimal points with the same value of the function to be optimized, local search effectively solves the global problem: finding a local optimum delivers a globally optimal solution. The locality of the optimum is dependent on the neighborhood structure as defined by the local search method that is used for optimizing the function. In many cases, local optima deliver sub- optimal solutions to the global problem, and a local search method needs to be modified to continue the search beyond local optimality; see for example iterated local search, tabu search, reactive search optimization, and simulated annealing.
|
|
Incidental decarburization can be detrimental to surface properties in products (where carbon content is desirable) when done during heat treatment or after rolling or forging, because the material is only affected to a certain depth according to the temperature and duration of heating. This can be prevented by using an inert or reduced-pressure atmosphere, applying resistive heating for a short duration, by limiting the time that material is under high heat, as is done in a walking-beam furnace, or through restorative carburization, which uses a hydrocarbon atmosphere to transfer carbon into the surface of the material during annealing. The decarburized surface material can also be removed by grinding.
|
|
Apart of his literary and musical activities, Canton holds a PhD in telecommunication engineering by the Technical University of Catalonia and is the author of a number of publications in the field of human-computer interaction. In 2009, he was selected to co-star a TV spot for the Technical University of Catalonia. Among his scientific contributions, he introduced the concept of structural annealing into the field of Monte Carlo methods. During his academic years at the Technical University of Catalonia, Canton was selected, together with a team of Catalan researchers, in 2002, to collaborate with the European Space Agency in one of the first parabolic flights.
|
|
The physical processes that fall under the designations of recovery, recrystallization and grain growth are often difficult to distinguish in a precise manner. Doherty et al. (1998) stated: > "The authors have agreed that ... recovery can be defined as all annealing > processes occurring in deformed materials that occur without the migration > of a high-angle grain boundary" Thus the process can be differentiated from recrystallization and grain growth as both feature extensive movement of high-angle grain boundaries. If recovery occurs during deformation (a situation that is common in high-temperature processing) then it is referred to as 'dynamic' while recovery that occurs after processing is termed 'static'.
|
|
The magnetic properties of glass- coated wires also differ greatly from the properties of amorphous wires and cold-drawn wires due to the difference of the internal stresses that are occurring in the wire. When choosing a metal for the wire Fe-rich compositions of metals typically hold an advantage over Co-rich compositions since Co is more expensive and Fe-rich metals have better magnetic properties. The magnetic properties such as the magnetic softness of Fe-rich materials can be improved by annealing the metal while it is under mechanical stresses. When a magnet is said to be "soft" it implies that the magnetic abilities are only temporary.
|
|
Donald Jay Geman (born September 20, 1943) is an American applied mathematician and a leading researcher in the field of machine learning and pattern recognition. He and his brother, Stuart Geman, are very well known for proposing the Gibbs sampler and for the first proof of the convergence of the simulated annealing algorithm, in an article that became a highly cited reference in engineering (over 21K citations according to Google Scholar, as of January 2018)Google Scholar: Stochastic Relaxation, Gibbs Distributions and the Bayesian Restoration.. He is a Professor at the Johns Hopkins University and simultaneously a visiting professor at École Normale Supérieure de Cachan.
|
|
Generally a number of measurements will be made on certain areas of the wafer and compared with expected values. As long as the measured values are within a certain range, the wafers are passed for continued processing. (This is known as statistical process control.) Other photo- modulated reflectance systems marketed for process control of implant processes are the "TWIN" metrology system marketed by PVA TePla AG, and the "PMR-3000" marketed by Semilab Co. Ltd (originally Boxer-Cross, Inc.). However, by the mid 2000s, new manufacturing processes were requiring new process control capabilities, for example the need for control of new "diffusion-less" annealing processes and advanced strained silicon processes.
|
|
Brunger is known for developing a computer program called CNS used for solving structures based on X-ray diffraction or solution NMR data, which was first released in 1992. The program is a major extension of a 1987 program developed with John Kuriyan and Karplus called X-PLOR, whose original inspiration was motivated by Marius Clore's efforts in interpreting NMR data and which has been extended by Clore's continued development of XPLOR-NIH. These programs make use of a method called simulated annealing in conjunction with molecular dynamics to refine protein structures. X-PLOR was the first time a modern optimization technique was applied to the problem of crystallographic refinement.
|
|
Zinc, cadmium, and even lead whiskers have been documented. Many techniques are used to mitigate the problem including changes to the annealing process (heating and cooling), addition of elements like copper and nickel, and the inclusion of conformal coatings. Traditionally, lead has been added to slow down whisker growth in tin-based solders. Following the Restriction of Hazardous Substances Directive (RoHS), the European Union banned the use of lead in most consumer electronic products from 2006 due to health problems associated with lead and the "high-tech trash" problem, leading to a re-focusing on the issue of whisker formation in lead-free solders.
|
|
This trend continues down to 100 K, below which resistivity rapidly decreases for fresh samples. Resistivity then begins to increase with time at around 20 K due to radiation damage, with the rate dictated by the isotopic composition of the sample. Because of self-irradiation, a sample of plutonium fatigues throughout its crystal structure, meaning the ordered arrangement of its atoms becomes disrupted by radiation with time. Self-irradiation can also lead to annealing which counteracts some of the fatigue effects as temperature increases above 100 K. Unlike most materials, plutonium increases in density when it melts, by 2.5%, but the liquid metal exhibits a linear decrease in density with temperature.
|
|
Because primers are designed to have low complementarity to each other, they may anneal (step I in the figure) only at low temperature, e.g. room temperature, such as during the preparation of the reaction mixture. Although DNA polymerases used in PCR are most active around 70 °C, they have some polymerizing activity also at lower temperatures, which can cause DNA synthesis from primers after annealing to each other. Several methods have been developed to prevent PDs formation until the reaction reaches working temperature (60-70 °C), and these include initial inhibition of the DNA polymerase, or physical separation of reaction components reaction until the reaction mixture reaches the higher temperatures.
|
|
Most practical algorithms for optimizing large logic systems use algebraic manipulations or binary decision diagrams, and there are promising experiments with genetic algorithms and annealing optimizations. To automate costly engineering processes, some EDA can take state tables that describe state machines and automatically produce a truth table or a function table for the combinational logic of a state machine. The state table is a piece of text that lists each state, together with the conditions controlling the transitions between them and the belonging output signals. It is common for the function tables of such computer-generated state-machines to be optimized with logic-minimization software such as Minilog.
|
|
The making of metal sheet often involves compression in one direction and, in efficient rolling operations, tension in another, which can orient crystallites in both axes by a process known as grain flow. However, cold work destroys much of the crystalline order, and the new crystallites that arise with annealing usually have a different texture. Control of texture is extremely important in the making of silicon steel sheet for transformer cores (to reduce magnetic hysteresis) and of aluminium cans (since deep drawing requires extreme and relatively uniform plasticity). Texture in ceramics usually arises because the crystallites in a slurry have shapes that depend on crystalline orientation, often needle- or plate-shaped.
|
|
During these excavations, a crucible (with remnants of scoria) was also found along with bracelets, socketed spearheads, axes and a bell. Chemical analysis of five antiquaries indicated 11.74 to 26.47% of lead which verifies that the technological techniques of casting and annealing were known during the period. However, the bronze items have been dated to late 200 BC. In 1994, radiocarbon dating by Roland Mourer suggests the prehistoric sequence for Samrong Sen as lying between 3400 BC and 500 AD. This has been confirmed by the Accelerator mass spectrometry (AMS) analysis, a methodology adopted to determine the concentration of carbon-14. Finds of Mansuy were further examined by French archaeologists in 1998 for human skeletons.
|
|
A schematic of a lamellar structure for a eutectic system Lamellar structures or microstructures are composed of fine, alternating layers of different materials in the form of lamellae. They are often observed in cases where a phase transformation front moves quickly, leaving behind two solid products, as in rapid cooling of eutectic (such as solder) or eutectoid (such as pearlite) systems. Such conditions force phases of different composition to form but allow little time for diffusion to produce those phases' equilibrium compositions. Fine lamellae solve this problem by shortening the diffusion distance between phases, but their high surface energy makes them unstable and prone to break up when annealing allows diffusion to progress.
|
|
After a double-strand break occurs, sections of DNA around the 5' ends of the break are cut away in a process called resection. In the strand invasion step that follows, an overhanging 3' end of the broken DNA molecule then "invades" a similar or identical DNA molecule that is not broken. After strand invasion, the further sequence of events may follow either of two main pathways discussed below (see Models); the DSBR (double-strand break repair) pathway or the SDSA (synthesis-dependent strand annealing) pathway. Homologous recombination that occurs during DNA repair tends to result in non-crossover products, in effect restoring the damaged DNA molecule as it existed before the double-strand break.
|
|
Lofting type brass thimble In 1693, a Dutch thimble manufacturer named John Lofting established a thimble manufactory in Islington, in London, England, expanding British thimble production to new heights. He later moved his mill to Buckinghamshire to take advantage of water-powered production, resulting in a capacity to produce more than two million thimbles per year. By the end of the 18th century, thimble making had moved to Birmingham, and shifted to the "deep drawing" method of manufacture, which alternated hammering of sheet metals with annealing, and produced a thinner-skinned thimble with a taller shape. At the same time, cheaper sources of silver from the Americas made silver thimbles a popular item for the first time.
|
|
In the late 1970s, the industry had moved away from metal (most typically aluminum, evaporated in a vacuum chamber onto the wafer surface), as the gate material in the metal- oxide-semiconductor stack due to fabrication complications. A material called polysilicon (polycrystalline silicon, highly doped with donors or acceptors to reduce its electrical resistance) was used to replace aluminum. Polysilicon can be deposited easily via chemical vapor deposition (CVD) and is tolerant to subsequent manufacturing steps which involve extremely high temperatures (in excess of 900–1000 °C), where metal was not. Particularly, metal (most commonly aluminum a Type III (P-type) dopant) has a tendency to disperse into (alloy with) silicon during these thermal annealing steps.
|
|
Due to the difficulty of solving to optimality large-scale instances of vehicle routing problems, a significant research effort has been dedicated to metaheuristics such as Genetic algorithms, Tabu search, Simulated annealing and Adaptive Large Neighborhood Search (ALNS). Some of the most recent and efficient metaheuristics for vehicle routing problems reach solutions within 0.5% or 1% of the optimum for problem instances counting hundreds or thousands of delivery points . These methods are also more robust in the sense that they can be more easily adapted to deal with a variety of side constraints. As such, the application of metaheuristic techniques is often preferred for large-scale applications with complicating constraints and decision sets.
|
|
The close proximity of the reporter to the quencher prevents detection of its fluorescence; breakdown of the probe by the 5' to 3' exonuclease activity of the Taq polymerase breaks the reporter-quencher proximity and thus allows unquenched emission of fluorescence, which can be detected after excitation with a laser. An increase in the product targeted by the reporter probe at each PCR cycle therefore causes a proportional increase in fluorescence due to the breakdown of the probe and release of the reporter. #The PCR is prepared as usual (see PCR), and the reporter probe is added. #As the reaction commences, during the annealing stage of the PCR both probe and primers anneal to the DNA target.
|
|
Each locus tested is differentiated by different bead types. Both bead types are attached to single-stranded 50-mer DNA oligonucleotides that differ in sequence only at the free end; this type of probe is known as an allele-specific oligonucleotide. One of the bead types will correspond to the methylated cytosine locus and the other will correspond to the unmethylated cytosine locus, which has been converted into uracil during bisulfite treatment and later amplified as thymine during whole-genome amplification. The bisulfite-converted amplified DNA products are denatured into single strands and hybridized to the chip via allele-specific annealing to either the methylation-specific probe or the non-methylation probe.
|
|
Full annealing temperature ranges A full anneal typically results in the second most ductile state a metal can assume for metal alloy. Its purpose is to originate a uniform and stable microstructure that most closely resembles the metal's phase diagram equilibrium microstructure, thus letting the metal attain relatively low levels of hardness, yield strength and ultimate strength with high plasticity and toughness. To perform a full anneal on a steel for example, steel is heated to slightly above the austenitic temperature and held for sufficient time to allow the material to fully form austenite or austenite-cementite grain structure. The material is then allowed to cool very slowly so that the equilibrium microstructure is obtained.
|
|
The design and analysis of approximation algorithms crucially involves a mathematical proof certifying the quality of the returned solutions in the worst case. This distinguishes them from heuristics such as annealing or genetic algorithms, which find reasonably good solutions on some inputs, but provide no clear indication at the outset on when they may succeed or fail. There is widespread interest in theoretical computer science to better understand the limits to which we can approximate certain famous optimization problems. For example, one of the long-standing open questions in computer science is to determine whether there is an algorithm that outperforms the 1.5 approximation algorithm of Christofides to the metric traveling salesman problem.
|
|
On the advice of his professor he took up the microscopic examination of metals, and spent some time at the Royal Mint studying the technique of his new work. This led to the discovery of "slip bands" and later, the phenomenon of spontaneous annealing in lead and other soft metals. In 1900 he became scientific adviser to Chance Brothers of Birmingham, glass manufacturers and lighthouse engineers, and for the next six years his work was chiefly concerned with the production of optical glass and lighthouse apparatus. In 1906 Rosenhain became the first superintendent of the department of metallurgy and metallurgical chemistry at the National Physical Laboratory, he held this position until 1931.
|
|
Adaptive dimensional search algorithms differ from nature-inspired metaheuristic techniques in the sense that they do not use any metaphor as an underlying principle for implementation. Rather, they utilize a simple, performance-oriented methodology based on the update of the search dimensionality ratio (SDR) parameter at each iteration.Hasançebi, O., Kazemzadeh Azad, S. (2015), Adaptive Dimensional Search: A New Metaheuristic Algorithm for Discrete Truss Sizing Optimization, Computers and Structures, 154, 1-16. Many robust metaheuristic techniques, such as simulated annealing, evolutionary algorithms, particle swarm optimization, and ant colony optimization, have been introduced by researchers in the last few decades through clearly identifying and formulating similarities between algorithms and the processes they are modeled on.
|
|
Glass was used in mosaics as early as 2500 BC, but it took until the 3rd century BC before innovative artisans in Greece, Persia and India created glass tiles. Whereas clay tiles are dated as early as 8000 BC, there were significant barriers to the development of glass tiles, included the high temperatures required to melt glass, and the complexities of mastering various annealing curves for glass. In recent years, glass tiles have become popular for both field and accent tiles. This trend can be attributed to recent technological breakthroughs, as well as the tiles’ inherent properties, in particular their potential to impart intense color and reflect light, and their imperviousness to water.
|
|
Historically, crystals were developed by experimentation, currently formalized as combinatorial chemistry, but one contemporary desideratum is the synthesis of materials designed in advance, and one proposal is to design crystals (the designs being crystal nets, perhaps represented as one unit cell of a crystal net) and then synthesize them from the design. This effort, in what Omar Yaghi described as reticular chemistry is proceeding on several fronts, from the theoretical to synthesizing highly porous crystals. One of the primary issues in annealing crystals is controlling the constituents, which can be difficult if the constituents are individual atoms, e.g., in zeolites, which are typically porous crystals primarily of silicon and oxygen and occasional impurities.
|
|
In hot start PCR, important reagents (such as DNA polymerase and magnesium cofactors) are prevented from reacting in the PCR mixture until the optimal temperatures are met through physical separation or chemical modifications. Hot start PCR can also occur when the Taq polymerase is inhibited/inactivated or its addition is delayed until optimal annealing temperatures, through deoxyribonucleotide triphosphate modifications or by modifying the primers through caging and secondary structure manipulation. Hot start PCR is often a better approach opposed to traditional PCR in circumstances where there is a lack of DNA in the reaction mix (>104 copies), the DNA template is highly complex or if there are several pairs of oligonucleotide primers in the PCR.
|
|
Oxer's secondary education was at St Michael's Grammar School where he completed his Higher School Certificate (HSC) in 1989. In 1987 Oxer was one of a group of students from the school who conducted an extra-curricular project to use information published by researchers at IBM Zurich, the University of Alabama, and the University of Houston to create a sample of yttrium-barium-copper-oxide (YBCO) superconductor capable of exhibiting superconducting properties at the temperature of liquid nitrogen, which at the time was the highest-temperature superconductor yet created Oxer's contributions to the project included writing software to plot the optimum cooling curve of the material to maximise crystal alignment during the annealing process.
|
|
CYANA (combined assignment and dynamics algorithm for NMR applications) is a program for automated structure calculation of biological macromolecules on the basis of conformational constraints from nuclear magnetic resonance (NMR). The combination of automated nuclear Overhauser effect spectroscopy (NOESY) cross peak assignment, structure calculation with a fast torsion angle dynamics algorithm. The CYANA package includes the previous DYANA system, that uses simulated annealing combined with molecular dynamics in torsion angle space (torsion angle dynamics). The target function used as the potential energy, and system can move away from local minima of the target function because it is coupled to a temperature bath which is cooled down slowly from its initial high temperature.
|
|
Nearly all metals can be softened by annealing, which recrystallizes the alloy and repairs the defects, but not as many can be hardened by controlled heating and cooling. Many alloys of aluminium, copper, magnesium, titanium, and nickel can be strengthened to some degree by some method of heat treatment, but few respond to this to the same degree as does steel. The base metal iron of the iron-carbon alloy known as steel, undergoes a change in the arrangement (allotropy) of the atoms of its crystal matrix at a certain temperature (usually between and , depending on carbon content). This allows the smaller carbon atoms to enter the interstices of the iron crystal.
|
|
In addition to silicon, MLD has also been applied to compound semiconductors such as indium arsenide (InAs) to obtain high quality ultra-shallow junctions. For the past years, controlling the post-growth dopant profiles in compound semiconductors such as III-V materials deterministically has not been well achieved due to the challenges in controlling the recovered stoichiometry after the implantation and sequential annealing. These residual damages can lead to higher junction leakage and lower dopant activation in compound semiconductors. Utilizing the MLD technique with sulfur dopants, a dopant profile abruptness of ~ 3.5 nm/decade with high electrically active sulfur concentrations of ~ 8–1018 cm−3 is observed in InAs without significant defect density. Remarkably.
|
|
In response, Springer's Journal of Heuristics has updated their editorial policy to state that:Journal of Heuristic Policies on Heuristic Search Research. Springer. > Proposing new paradigms is only acceptable if they contain innovative basic > ideas, such as those that are embedded in classical frameworks like genetic > algorithms, tabu search, and simulated annealing. The Journal of Heuristics > avoids the publication of articles that repackage and embed old ideas in > methods that are claimed to be based on metaphors of natural or manmade > systems and processes. These so-called "novel" methods employ analogies that > range from intelligent water drops, musicians playing jazz, imperialist > societies, leapfrogs, kangaroos, all types of swarms and insects and even > mine blast processes (Sörensen, 2013).
|
|
At finite temperature, the molecule spends most of its time in these low-lying states, which thus dominate the molecular properties. Global optimization can be accomplished using simulated annealing, the Metropolis algorithm and other Monte Carlo methods, or using different deterministic methods of discrete or continuous optimization. While the force field represents only the enthalpic component of free energy (and only this component is included during energy minimization), it is possible to include the entropic component through the use of additional methods, such as normal mode analysis. Molecular mechanics potential energy functions have been used to calculate binding constants, protein folding kinetics, protonation equilibria, active site coordinates, and to design binding sites.
|
|
In general, the CAFM can monitor the effect of any process that introduces local changes in the structure of the dielectric, including thermal annealing, dopping and irradiation, among others. 323x323px Apart from monitoring the electrical properties of a dielectric, the CAFM can be also used to alter its properties by applying an electrical field locally. In particular, the CAFM is especially useful to determine which locations of the samples lead to premature BD, which can provide essential information about the reliability of the samples. The CAFM also helped to confirm the percolation theory of the BD by experimentally proving that this is a very local phenomenon that occurs in small areas typically below 100 nm2.
|
|
Thresheld Convergence (TC) is a diversification technique which attempts to separate the processes of exploration and exploitation. TC uses a “threshold” function to establish a minimum search step, and managing this step makes it possible to influence the transition from exploration to exploitation, convergence is thus “held” back until the last stages of the search process . The goal of a controlled transition is to avoid an early concentration of the population around a few search regions and avoid the loss of diversity which can cause premature convergence. Thresheld Convergence has been successfully applied to several population-based metaheuristics such as Particle Swarm Optimization, Differential evolution , Evolution strategies , Simulated annealing and Estimation of Distribution Algorithms.
|
|
As well as allowing the formation of shapes that are difficult to machine, the process allows pre-hardened moulds to be shaped so that no heat treatment is required. Changes to a hardened mould by conventional drilling and milling normally require annealing to soften the mould, followed by heat treatment to harden it again. EDM is a simple process in which a shaped electrode, usually made of copper or graphite, is very slowly lowered onto the mould surface over a period of many hours, which is immersed in paraffin oil (kerosene). A voltage applied between tool and mould causes spark erosion of the mould surface in the inverse shape of the electrode.
|
|
During heat treating, a blacksmith causes phase changes in the iron-carbon system in order to control the material's mechanical properties, often using the annealing, quenching, and tempering processes. In this context, the color of light, or "blackbody radiation," emitted by the workpiece is an approximate gauge of temperature. Temperature is often gauged by watching the color temperature of the work, with the transition from a deep cherry-red to orange-red ( to ) corresponding to the formation of austenite in medium and high-carbon steel. In the visible spectrum, this glow increases in brightness as temperature increases, and when cherry-red the glow is near its lowest intensity and may not be visible in ambient light.
|
|
All treatments of steel trade ductility for increased strength and vice versa. Iron has a higher solubility for carbon in the austenite phase; therefore all heat treatments, except spheroidizing and process annealing, start by heating the steel to a temperature at which the austenitic phase can exist. The steel is then quenched (heat drawn out) at a moderate to low rate allowing carbon to diffuse out of the austenite forming iron-carbide (cementite) and leaving ferrite, or at a high rate, trapping the carbon within the iron thus forming martensite. The rate at which the steel is cooled through the eutectoid temperature (about 727 °C) affects the rate at which carbon diffuses out of austenite and forms cementite.
|
|
Medieval glasshouse traditions continued in the Weald, which was becoming deforested by the early 17th century; local glassmaking spread elsewhere, where timber was available to fire furnaces, to Hampshire, Gloucestershire, North Staffordshire and the Scottish Borders. At Bagot's Park, Staffordshire, one such glasshouse has been recovered, which dates from circa 1535; it contained an early melting furnace and a smaller annealing furnace. The melting furnace had two siege benchesThe siege is the floor of a glass-furnace. for the placement of three crucible pots, each with a central flue cut into the floor to create a draught that would allow the furnace to achieve 1200 °C in order to melt the glass.
|
|
While most polypropylene homopolymers are too brittle and most polypropylene copolymers are too soft, certain grades of polypropylene polymers are stiff enough for engineering purposes, yet soft enough so that a geosynthetic can be handled for installation. These polymers are modified, via proprietary treatment processes and the addition of additives such as nanoparticles to attain the required physical properties. Unlike low crystalline polymers such as polypropylene, which require a post-extrusion processing such as orientation, cross-linking, and/or thermal annealing, higher crystalline polymers such as novel polymeric Alloy can be extruded as strips and welded in section without post-extrusion treatment. The sheet can be extruded into strips and welded, sown, or bonded together to form geosynthetic products.
|
|
Deformation, metamorphism, and magmatism in the East Athabasca mylonite triangle, northern Saskatchewan: implications for the Archean and Early Proterozoic crustal structure of the Canadian Shield. The porphyroblast of garnet was formed during high grade metamorphism while the porphyroblast of cordierite was formed during subsequent exhumation. Both porphyroblasts contain monazite inclusions which were dated at 1910 Ma and 1840 Ma, respectively. And matrix monazite is dated 1800 Ma. Thus, it is interpreted that high grade metamorphism occurred after 1910 Ma and before 1840 Ma, while exhumation occurred after 1840 Ma, and the final annealing (cooling and coarsening of minerals) happened at 1800 Ma. Within the same setting as above, monazite inclusions in garnet maybe either younger than, older than or have similar ages with the matrix monazite.
|
|
The Centurion Reactor is a future class of nuclear reactor that is being designed to last 100 years.Sherrell R. Greene, "Centurion Reactors – Achieving Commercial Power Reactors With 100+ Year Operating Lifetimes'", Oak Ridge National Laboratory, published in transactions of Winter 2009 American Nuclear Society National Meeting, November 2009, Washington, D.C. One of the major limiting wear factors is the deterioration of the reactor's pressure vessel under the action of neutron bombardment, however in 2018 Rosatom announced it had developed a thermal annealing technique for reactor pressure vessels which ameliorates radiation damage and extends service life by between 15 and 30 years. Decommissioning involves many administrative and technical actions. It includes all clean-up of radioactivity and progressive demolition of the station.
|
|
Another class of LDH is known where the main metal layer (c) consists of Li+ and Al3+ cations, with the general formula : [()6]+ [(X6−) ∙ y]−, where X6− represents one or more anions with total charge −6. The value of y is usually between 0.5 and 4. In some cases, the pH value of the solution used during the synthesis and the high drying temperature of the LDH can eliminate the presence of the OH− groups in the LDH. For example, in the synthesis of the (BiO)4(OH)2CO3 compound, a low pH value of the aqueous solution or higher annealing temperature of solid can induce the formation of (BiO)2CO3, which is thermodynamically more stable than the LDH compound, by exchanging OH− groups by CO32- groups.
|
|
The repair pathway is partially determined by the amount of ATP present after the removal of the deoxyribose phosphate end. The long patch repair pathway is preferred under conditions of low ATP concentration while the short repair pathway is preferred under high concentrations of ATP. Other notable interactions include MUTYH and Replication protein A is a single strand binding protein that prevents the annealing of DNA during replication, it also plays a role as an activator for damage repair on DNA. There is a hypothetical relation between the interaction of Mismatch Repair proteins (MMR) such as MSH 2,3 and 6, MLH1, PMS1 and 2, and MUTYH in which the proposed result of their partnering is to increase susceptibility to cancer.
|
|
Microsatellites can be amplified for identification by the polymerase chain reaction (PCR) process, using the unique sequences of flanking regions as primers. DNA is repeatedly denatured at a high temperature to separate the double strand, then cooled to allow annealing of primers and the extension of nucleotide sequences through the microsatellite. This process results in production of enough DNA to be visible on agarose or polyacrylamide gels; only small amounts of DNA are needed for amplification because in this way thermocycling creates an exponential increase in the replicated segment. With the abundance of PCR technology, primers that flank microsatellite loci are simple and quick to use, but the development of correctly functioning primers is often a tedious and costly process.
|
|
Large accumulations of coal, which have remained inert for hundreds of millions of years in the absence of oxygen, may spontaneously combust when exposed to air in coal mine waste tips, ship cargo holds and coal bunkers, and storage dumps. In nuclear applications where graphite is used as a neutron moderator, accumulation of Wigner energy followed by a sudden, spontaneous release may occur. Annealing to at least 250 °C can release the energy safely, although in the Windscale fire the procedure went wrong, causing other reactor materials to combust. The great variety of carbon compounds include such lethal poisons as tetrodotoxin, the lectin ricin from seeds of the castor oil plant Ricinus communis, cyanide (CN), and carbon monoxide; and such essentials to life as glucose and protein.
|
|
Lattice displacement is caused by neutrons, protons, alpha particles, heavy ions, and very high energy gamma photons. They change the arrangement of the atoms in the crystal lattice, creating lasting damage, and increasing the number of recombination centers, depleting the minority carriers and worsening the analog properties of the affected semiconductor junctions. Counterintuitively, higher doses over short time cause partial annealing ("healing") of the damaged lattice, leading to a lower degree of damage than with the same doses delivered in low intensity over a long time (LDR or Low Dose Rate). This type of problem is particularly significant in bipolar transistors, which are dependent on minority carriers in their base regions; increased losses caused by recombination cause loss of the transistor gain (see neutron effects).
|
|
The diversity of strains present in the Enterobacter cowanii species have been confirmed through analysis of DNA G+C content and DNA-DNA Hybridization results, which involves the hybridizing (annealing) of putative strains to E. cowanii LMG 23569T. A DNA similarity of 70% or greater indicates that strains of interest are the same species. When testing for DNA- DNA similarity comparing the rpoB gene of E. cowanii, the strains BCC 009, BCC 011, BCC 078 showed 76% to 92% DNA similarity. N.B. Using a multilocus sequence analysis (MLSA) approach, based on partial sequencing of protein- encoding genes (gyrB, rpoB, infB and atpD), this species has been reclassified to the genus Kosakonia, so that its name is more properly given as Kosakonia cowanii.
|
|
Precipitation strengthening is possible if the line of solid solubility slopes strongly toward the centre of a phase diagram. While a large volume of precipitate particles is desirable, a small enough amount of the alloying element should be added that it remains easily soluble at some reasonable annealing temperature. Elements used for precipitation strengthening in typical aluminium and titanium alloys make up about 10% of their composition. While binary alloys are more easily understood as an academic exercise, commercial alloys often use three components for precipitation strengthening, in compositions such as Al(Mg, Cu) and Ti(Al, V). A large number of other constituents may be unintentional, but benign, or may be added for other purposes such as grain refinement or corrosion resistance.
|
|
Fully reduced lithium cobalt oxide can be prepared by heating a stoichiometric mixture of lithium carbonate and cobalt(II,III) oxide or metallic cobalt at 600–800°C, then annealing the product at 900°C for many hours, all under an oxygen atmosphere. Nanometer-sized and sub-micrometer sized LCO synthesis route Nanometer-size particles more suitable for cathode use can also be obtained by calcination of hydrated cobalt oxalate β-·2, in the form of rod-like crystals about 8 μm long and 0.4 μm wide, with lithium hydroxide , up to 750–900°C. A third method uses lithium acetate, cobalt acetate, and citric acid in equal molar amounts, in water solution. Heating at 80°C turns the mixture into a viscous transparent gel.
|
|
A corroded copper ingot from Zakros, Crete, shaped in the form of an animal skin typical in that era. Copper occurs naturally as native copper and was known to some of the oldest civilizations on record. It has a history of use that is at least 10,000 years old, and estimates of its discovery place it at 9000 BC in the Middle East; a copper pendant was found in northern Iraq that dates to 8700 BC. There is evidence that gold and meteoric iron (but not iron smelting) were the only metals used by humans before copper. The history of copper metallurgy is thought to have followed the following sequence: 1) cold working of native copper, 2) annealing, 3) smelting, and 4) the lost wax method.
|
|
For multimodal distributions, this means that an EM algorithm may converge to a local maximum of the observed data likelihood function, depending on starting values. A variety of heuristic or metaheuristic approaches exist to escape a local maximum, such as random- restart hill climbing (starting with several different random initial estimates θ(t)), or applying simulated annealing methods. EM is especially useful when the likelihood is an exponential family: the E step becomes the sum of expectations of sufficient statistics, and the M step involves maximizing a linear function. In such a case, it is usually possible to derive closed-form expression updates for each step, using the Sundberg formula (published by Rolf Sundberg using unpublished results of Per Martin-Löf and Anders Martin-Löf).
|
|
In 2015, a research group led by Jagdish Narayan, a professor of materials science and engineering at North Carolina State University, and graduate student Anagh Bhaumik announced the discovery of Q-carbon. They also announced the discovery of Q-boron nitride (Q-BN), and the conversion of carbon into diamond and h-BN into c-BN at ambient temperatures and air pressures. The process started with Narayan's papers on laser annealing, published in Science, and culminated in 2015–16 with another series of papers and three United States patent applications: 62/245,108 (2015); 62/202,202 (2015); and 62/331.217 (2016). These have been licensed by Q-Carbon IncQ Carbon Inc to commercialize products based on Q-carbon, diamond, Q-BN and c-BN.
|
|
The massive power excursion in Chernobyl during a mishandled test led to the rupture of the reactor vessel and a series of steam explosions, which destroyed the reactor building. Now exposed to both air and the heat from the reactor core, the graphite moderator in the reactor core caught fire, and this fire sent a plume of highly radioactive fallout into the atmosphere and over an extensive geographical area. In addition, the French Saint-Laurent Nuclear Power Plant and the Spanish Vandellòs Nuclear Power Plant – both UNGG graphite-moderated natural uranium reactors – suffered major accidents. Particularly noteworthy is a partial core meltdown on 17 October 1969 and an heat excursion during graphite annealing on 13 March 1980 in Saint-Laurent, which were both classified as INES 4.
|
|
Monolayer doping (MLD) is a well controlled, wafer-scale surface doping technique first developed at the University of California, Berkeley, in 2007. This work is aimed for attaining controlled doping of semiconductor materials with atomic accuracy, especially at nanoscale, which is not easily obtained by other existing technologies. This technique is currently used for fabricating ultrashallow junctions (USJs) as the heavily doped source/drain (S/D) contacts of metal-oxide-semiconductor field effect transistors (MOSFETs) as well as enabling dopant profiling of nanostructures. This MLD technique utilizes the crystalline nature of semiconductors and its self-limiting surface reaction properties to form highly uniform, self-assembled, covalently bonded dopant- containing monolayers followed by a subsequent annealing step for the incorporation and diffusion of dopants.
|
|
The relative merits of EM and other algorithms vis-à-vis convergence have been discussed in other literature. Other common objections to the use of EM are that it has a propensity to spuriously identify local maxima, as well as displaying sensitivity to initial values. One may address these problems by evaluating EM at several initial points in the parameter space but this is computationally costly and other approaches, such as the annealing EM method of Udea and Nakano (1998) (in which the initial components are essentially forced to overlap, providing a less heterogeneous basis for initial guesses), may be preferable. Figueiredo and Jain note that convergence to 'meaningless' parameter values obtained at the boundary (where regularity conditions breakdown, e.g.
|
|
Some important events during this phase included: the new Saxon rhomb trademark was introduced; three large new furnaces for annealing and glost were built: and a new steam engine was purchased to operate the mill on the large factory floor. Other innovations and measures to modernise took place during this period, which was characterized by an ever- increasing degree of mechanisation of operations. An important element was the establishment of a railway line between Blankenhain and Weimar in 1887; this provided a major advantage for the factory, which by that time had already been producing mainly large quantities of porcelain goods. So in 1879 with transport costing less and production numbers steadily increasing, sons Max and Karl Fasolt took over the running of the company.
|
|
Most recombination events appear to be the SDSA type. In genetics, the initial processes involved in repair of a double- strand break by synthesis-dependent strand annealing (SDSA) are identical to those in the double Holliday junction model, and have been most extensively studied in yeast species Saccharomyces cerevisiae. Following a double-stranded break, a protein complex (MRX) binds to either end of the break, working with DNA nucleases to carry out resection, resulting in 5' end digest to produce 3' overhangs of single-stranded DNA (see Figure). These overhangs are then bound to form a nucleoprotein filament, which can then locate DNA sequences similar to one of the 3' overhangs, initiating a single-stranded strand invasion into the DNA duplex containing these sequences.
|
|
This displaced strand pops up to form a 3' overhang in the original double-stranded break duplex, which can then anneal to the opposite end of the original break through complementary base pairing. Thus DNA synthesis fills in gaps left over from annealing, and extends both ends of the still present single stranded DNA break, ligating all remaining gaps to produce recombinant non-crossover DNA. SDSA is unique in that D-loop translocation results in conservative rather than semiconservative replication, as the first extended strand is displaced from its template strand, leaving the homologous duplex intact. Therefore, although SDSA produces non-crossover products because flanking markers of heteroduplex DNA are not exchanged, gene conversion does occur, wherein nonreciprocal genetic transfer takes place between two homologous sequences.
|
|
On May 25, 2011 D-Wave announced that Lockheed Martin Corporation entered into an agreement to purchase a D-Wave One system. On October 28, 2011 USC's Information Sciences Institute took delivery of Lockheed's D-Wave One. In May 2013 it was announced that a consortium of Google, NASA Ames and the non-profit Universities Space Research Association purchased an adiabatic quantum computer from D-Wave Systems with 512 qubits.V. N. Smelyanskiy, E. G. Rieffel, S. I. Knysh, C. P. Williams, M. W. Johnson, M. C. Thom, W. G. Macready, K. L. Pudenz, "A Near- Term Quantum Computing Approach for Hard Computational Problems in Space Exploration", An extensive study of its performance as quantum annealer, compared to some classical annealing algorithms, is already available.
|
|
Knapsack problem: The ants prefer the smaller drop of honey over the more abundant, but less nutritious, sugar Ant colony optimization algorithms have been applied to many combinatorial optimization problems, ranging from quadratic assignment to protein folding or routing vehicles and a lot of derived methods have been adapted to dynamic problems in real variables, stochastic problems, multi- targets and parallel implementations. It has also been used to produce near- optimal solutions to the travelling salesman problem. They have an advantage over simulated annealing and genetic algorithm approaches of similar problems when the graph may change dynamically; the ant colony algorithm can be run continuously and adapt to changes in real time. This is of interest in network routing and urban transportation systems.
|
|
Prp 24 RRM 3 Prp24 has a molecular weight of 50 kDa and has been shown to contain four RNA recognition motifs (RRMs) and a conserved 12-amino acid sequence at the C-terminus. RRMs 1 and 2 have been shown to be important for high-affinity binding of U6, while RRMs 3 and 4 bind at lower affinity sites on U6. The first three RRMs interact extensively with each other and contain canonical folds that contain a four- stranded beta-sheet and two alpha-helices. The electropositive surface of RRMs 1 and 2 is a RNA annealing domain while the cleft between RRMs 1 and 2 including the beta-sheet face of RRM2 is a sequence-specific RNA binding site.
|
|
At these frequencies a ferromagnetic material such as mild steel is much more effective, due to different and complementary electromagnetic permeability properties, and common practical shielding implementations utilise both an inner high- frequency reflective material such as aluminium, preferably bonded (via annealing or electroplating, done to avoid capacitance between separated layers), to a more substantial structural ferromagnetic shell, usually mild steel (in specialized applications, more expensive, less structurally useful and less workable materials may be preferred.) Despite the relative low mass density of aluminium, this design is usually both lighter and more effective than an equivalently absorptive design utilizing aluminium alone (although with poorer heat dissipative properties, typically accommodated by improved ventilation, which itself needs careful consideration in order to preserve the desired shielding effectiveness).
|
|
Manufacturing costs and delivery schedules are also a major part of optical design. The price of an optical glass blank of given dimensions can vary by a factor of fifty or more, depending on the size, glass type, index homogeneity quality, and availability, with BK7 usually being the cheapest. Costs for larger and/or thicker optical blanks of a given material, above 100–150 mm, usually increase faster than the physical volume due to increased blank annealing time required to achieve acceptable index homogeneity and internal stress birefringence levels throughout the blank volume. Availability of glass blanks is driven by how frequently a particular glass type is made by a given manufacturer, and can seriously affect manufacturing cost and schedule.
|
|
Moreover, because the assembly of the full-length gene product relies on the efficient and specific alignment of long single stranded oligonucleotides, critical parameters for synthesis success include extended sequence regions comprising secondary structures caused by inverted repeats, extraordinary high or low GC-content, or repetitive structures. Usually these segments of a particular gene can only be synthesized by splitting the procedure into several consecutive steps and a final assembly of shorter sub-sequences, which in turn leads to a significant increase in time and labor needed for its production. The result of a gene synthesis experiment depends strongly on the quality of the oligonucleotides used. For these annealing based gene synthesis protocols, the quality of the product is directly and exponentially dependent on the correctness of the employed oligonucleotides.
|
|
The name and inspiration of the algorithm demand an interesting feature related to the temperature variation to be embedded in the operational characteristics of the algorithm. This necessitates a gradual reduction of the temperature as the simulation proceeds. The algorithm starts initially with T set to a high value (or infinity), and then it is decreased at each step following some annealing schedule—which may be specified by the user, but must end with T=0 towards the end of the allotted time budget. In this way, the system is expected to wander initially towards a broad region of the search space containing good solutions, ignoring small features of the energy function; then drift towards low-energy regions that become narrower and narrower; and finally move downhill according to the steepest descent heuristic.
|
|
Narayan developed domain matching epitaxy (DME), which involves matching of integral multiples of lattice planes, addressing the epitaxial growth of heterostructures across the misfit scale. Domain matching epitaxy led to the integration of oxides and III-nitrides on industrially relevant (100) Si and sapphire substrates (US Patent # 7,803,717) (US Patents # 5,406,123 & 6,955,985). His research group at NC State focuses on the controlled fabrication and processing of novel nanomaterials utilizing the pulsed laser deposition using PLD and Laser MBE units, thermal processing of materials using nanosecond laser annealing and generating new epitaxial heterostructures across the misfit scale, utilizing domain matching epitaxy. The fabrication approach is complemented with the high-resolution scanning/transmission electron microscopy for analysis of defects and interfaces at atomic-scale to correlate the device performance with atomic structure.
|
|
Disadvantages of RCC are that it is currently expensive to manufacture, is heavy, and lacks robust impact resistance.Columbia Accident Investigation Board report Some high-velocity aircraft, such as the SR-71 Blackbird and Concorde, deal with heating similar to that experienced by spacecraft, but at much lower intensity, and for hours at a time. Studies of the SR-71's titanium skin revealed that the metal structure was restored to its original strength through annealing due to aerodynamic heating. In the case of the Concorde, the aluminium nose was permitted to reach a maximum operating temperature of (approximately warmer than the normally sub-zero, ambient air); the metallurgical implications (loss of temper) that would be associated with a higher peak temperature were the most significant factors determining the top speed of the aircraft.
|
|
Recently, it has been found that the avalanches from an SOC process, like the BTW model, make effective patterns in a random search for optimal solutions on graphs. An example of such an optimization problem is graph coloring. The SOC process apparently helps the optimization from getting stuck in a local optimum without the use of any annealing scheme, as suggested by previous work on extremal optimization. The recent excitement generated by scale-free networks has raised some interesting new questions for SOC-related research: a number of different SOC models have been shown to generate such networks as an emergent phenomenon, as opposed to the simpler models proposed by network researchers where the network tends to be assumed to exist independently of any physical space or dynamics.
|
|
In 1979 the simplest molecular chromium(II) hydride with the chemical formula (systematically named chromane(2) and dihydridochromium) was synthesised and identified for the first time. It was synthesised directly from the elements, in a reaction sequence which consisted of simultaneous sublimation of chromium to atomic chromium and thermolysis of hydrogen, and concluded with codeposition in a cryogenic argon matrix to form chromane(2). In 2003 the dimer with the chemical formula (systematically named dichromane(4) and di-μ- hydrido-bis(hydridochromium)) was synthesised and identified for the first time. It was also synthesised directly from the elements, in a reaction sequence which consisted of laser ablation of chromium to atomic chromium, followed by codeposition with hydrogen in a cryogenic matrix to produce chromane(2), and concluded with annealing to form dichromane(4).
|
|
Developed by James Hartledsay in 1848. The glass is taken from the furnace in large iron ladles, which are carried upon slings running on overhead rails; from the ladle the glass is thrown upon the cast-iron bed of a rolling-table; and is rolled into sheet by an iron roller, the process being similar to that employed in making plate-glass, but on a smaller scale. The sheet thus rolled is roughly trimmed while hot and soft, so as to remove those portions of glass which have been spoiled by immediate contact with the ladle, and the sheet, still soft, is pushed into the open mouth of an annealing tunnel or temperature-controlled oven called a lehr, down which it is carried by a system of rollers.
|
|
Sandwich Glass Museum Sandwich Glass Museum is a glass museum in Sandwich, Massachusetts, featuring a wide range of rare glass, including glass from the local Boston & Sandwich Glass Factory which was founded in Sandwich by Deming Jarves in 1825. The Sandwich glass works primarily manufactured pressed lead- based glass, and was known for its use of color.Harriet Buxton Barbour, The Town That Glass Built, Houghton Mifflin Co. (Boston), 1948 The museum also has a live glass blower, and exhibits detailing the creation and coloring of various types of rare glass.Sandwich Glass Museum It has a furnace for clear glass heated to 2200 deg F that it runs 24x7 that shuts down only five years, and a computerized annealing oven to slowly cool down over a full day any new creations to help prevent cracking.
|
|
"Peale's machine gun" was put aside by Mint staff as useless soon after its introduction. An 1853 attempt by Peale to convert the Philadelphia Mint's wood-burning annealing furnaces to use anthracite coal destroyed the furnaces, cost the government several thousand dollars, and led to Peale being ordered to undertake no more such projects. One invention that worked well was the "noisy sofa"—sitting on it set off a trumpet blast. Constructed at the cost of about $200 in government funds, it graced in turn the offices of Peale and Patterson. The pressing and milling room of the Philadelphia Mint, 1852 These activities were financed through a provision of the Mint Act of 1837 that Patterson interpreted to allow the Mint to decline to give credit for small amounts of silver in gold deposits.
|
|
In June 2014, D-Wave announced a new quantum applications ecosystem with computational finance firm 1QB Information Technologies (1QBit) and cancer research group DNA-SEQ to focus on solving real-world problems with quantum hardware. As the first company dedicated to producing software applications for commercially available quantum computers, 1QBit's research and development arm has focused on D-Wave's quantum annealing processors and has successfully demonstrated that these processors are suitable for solving real-world applications. With demonstrations of entanglement published, the question of whether or not the D-Wave machine can demonstrate quantum speedup over all classical computers remains unanswered. A study published in Science in June 2014, described as "likely the most thorough and precise study that has been done on the performance of the D-Wave machine"Helmut Katzgraber, quoted in .
|
|
The powders are cooled, reground and calcined again. This process is repeated several times to get homogeneous material. The powders are subsequently compacted to pellets and sintered. The sintering environment such as temperature, annealing time, atmosphere and cooling rate play a very important role in getting good high-Tc superconducting materials. The YBa2Cu3O7−x compound is prepared by calcination and sintering of a homogeneous mixture of Y2O3, BaCO3 and CuO in the appropriate atomic ratio. Calcination is done at 900–950 °C, whereas sintering is done at 950 °C in an oxygen atmosphere. The oxygen stoichiometry in this material is very crucial for obtaining a superconducting YBa2Cu3O7−x compound. At the time of sintering, the semiconducting tetragonal YBa2Cu3O6 compound is formed, which, on slow cooling in oxygen atmosphere, turns into superconducting YBa2Cu3O7−x.
|
|
Mammalian cells with mutant ERCC1–XPF are moderately more sensitive than normal cells to agents (such as ionizing radiation) that cause double-stranded breaks in DNA. Particular pathways of both homologous recombination repair and non-homologous end-joining rely on ERCC1-XPF function. The relevant activity of ERCC1–XPF for both types of double-strand break repair is the ability to remove non-homologous 3′ single-stranded tails from DNA ends before rejoining. This activity is needed during a single-strand annealing subpathway of homologous recombination. Trimming of 3’ single- stranded tails is also needed in a mechanistically distinct subpathway of non- homologous end-joining, independent of the Ku proteins Homologous integration of DNA, an important technique for genetic manipulation, is dependent on the function of ERCC1-XPF in the host cell.
|
|
With his colleagues at DuPont he employed chemical quench and other techniques to trap and identify the 6-carbon reaction intermediate of the carboxylation reaction and defined the complete stereo-chemical course of the reaction. In 1989, using an unequivocally unfolded protein and the purified chaperonin proteins GroEL and GroES, his group was the first to demonstrate the ATP-dependent folding of RuBisCO and many other proteins. With Devarajan (Dave) Thirumalai he performed a bioinformatic analysis to define the structural elements of the substrate proteins that GroEL recognizes. Lorimer has also shown that GroEL can perform work on substrate protein during allosteric transitions. He has determined the crystal structure of the functional form, the symmetric GroEL:GroES2 “football” and established that the GroEL rings operate as parallel-processing, iterative annealing machines.
|
|
Intrinsic transcription terminators or Rho-independent terminators require the formation of a self-annealing hairpin structure on the elongating transcript, which results in the disruption of the mRNA-DNA-RNA polymerase ternary complex. The terminator sequence in DNA contains a 20 basepair GC-rich region of dyad symmetry followed by a short poly-A tract or "A stretch" which is transcribed to form the terminating hairpin and a 7–9 nucleotide "U tract" respectively. The mechanism of termination is hypothesized to occur through a combination of direct promotion of dissociation through allosteric effects of hairpin binding interactions with the RNA polymerase and "competitive kinetics". The hairpin formation causes RNA polymerase stalling and destabilization, leading to a greater likelihood that dissociation of the complex will occur at that location due to increased time spent paused at that site and reduced stability of the complex.
|
|
Removal of non-diamond carbon with wet chemicals had been accomplished by boiling in mixtures of sulphuric and chromic acid. When applied to a diamond substrate with an ion implantation damage profile as may be used for basic science, crystal growth, or device fabrication,United States Patent Number 5385762 the electrochemical approach makes it easier to preserve the thin film of less damaged diamond lying above the implant range, and it has been used in annealing experiments to fix the diamond after implantation damage has occurred. In some cases, thermal cycling may be an issue and selectivity to various masks may be important, so the lower temperatures and more flexible chemistry may offer benefits over prior art. The method does not require the use of non-volatile materials such as chrome, possibly reducing contamination problems in some applications.
|
|
A 1701 gold Louis d'or, overstruck using Castaing's method. An older 1690s date is visible on the reverse In 1688, Castaing proposed a method of reshaping and restriking existing coins, both as a response to counterfeiting and to help the Louis XIV raise money to support the Nine Years' War. The French government approved Castaing's method, because it was considerably less costly than the alternative method of melting the coins before restriking them. A Paris tinsmith, Martin Masselin, was chosen to undertake the job of annealing, blanching, and edge-marking the recoined pieces; he was paid fourteen deniers for each coin, with an additional 17 deniers for each restruck within the first three months of his contract. In 17 months of his contract, a deficit of 150,000 livres was discovered at the Paris Mint, and Masselin was charged with stealing the pieces.
|
|
By a careful choice of temperatures and number of systems one can achieve an improvement in the mixing properties of a set of Monte Carlo simulations that exceeds the extra computational cost of running parallel simulations. Other considerations to be made: increasing the number of different temperatures can have a detrimental effect, as one can think of the 'lateral' movement of a given system across temperatures as a diffusion process. Set up is important as there must be a practical histogram overlap to achieve a reasonable probability of lateral moves. The parallel tempering method can be used as a super simulated annealing that does not need restart, since a system at high temperature can feed new local optimizers to a system at low temperature, allowing tunneling between metastable states and improving convergence to a global optimum.
|
|
The chemical compositions of some types of glass can make them more vulnerable to devitrification than others, for example a high lime content can be factor in inducing this condition. In general opaque glass can devit easily as crystals are present in the glass to give its opaque appearance and thus the higher the chance it might devit. Techniques for avoiding devitrification include cleaning the glass surfaces of dust or unwanted residue, and allowing rapid cooling once the piece reaches the desired temperature, until the temperature approaches the annealing temperature. Devit spray can be purchased to apply to the surfaces of the glass pieces prior to firing which is supposed to help prevent devitrification, however there is disagreement over the long term effectiveness of this solution and whether it should be used as a substitute for proper firing techniques.
|
|
Soken tester Testing head on the sample of electrical steel Soken tester - is a portable single yoke instrument for assessing the power loss in electrical steel laminations. It has been developed for quick assessment of power loss in electrical steel sheet without the need for cutting and annealing, as it is the case for standardised methods like Epstein frame. The power loss can be estimated at 1.0 T, 1.5 T and 1.7 T and two frequencies 50 Hz and 60 Hz. Lamination thickness can be set within a range from 0.01 mm to 0.99 mm and there is no option for selecting the material density.Jeremy P. Hall, Evaluation of residual stress in electrical steel, PhD Thesis, School of Engineering, Cardiff University, 2001 The power loss is measured as a product of magnetic field and flux density.
|
|
However, for optimal ligation efficiency with cohesive-ended fragments ("sticky ends"), the optimal enzyme temperature needs to be balanced with the melting temperature Tm of the sticky ends being ligated, the homologous pairing of the sticky ends will not be stable because the high temperature disrupts hydrogen bonding. A ligation reaction is most efficient when the sticky ends are already stably annealed, and disruption of the annealing ends would therefore result in low ligation efficiency. The shorter the overhang, the lower the Tm. Since blunt-ended DNA fragments have no cohesive ends to anneal, the melting temperature is not a factor to consider within the normal temperature range of the ligation reaction. The limiting factor in blunt end ligation is not the activity of the ligase but rather the number of alignments between DNA fragment ends that occur.
|
|
After several years working as a member of the Technical Staff at Bell Laboratories (BTL) at Murray Hill, NJ, developing an ultrasonic amplifier, a mechanism invented by D. L. White, Tsu moved to the IBM, T.J. Watson Research Center in Yorktown Heights, NY as an associate to Leo Esaki beginning a well-known collaboration that yielded a theory of man-made quantum materials, superlattices and quantum wells. Later, Tsu joined the Amorphous Semiconductors Institute (ASI) and directed energy research at Energy Conversion Devices (ECD) near Detroit, MI, as invited by inventor Stan Ovshinsky. His contribution included the first experimental determination of the volume fraction of crystallinity for conductivity percolation in amorphous silicon and [germanium], and providing experimental proof of the existence of an intermediate order. He discovered experimentally that post annealing with H2 and O2 can drastically remove dangling bond defects in amorphous silicon.
|
|
During the next thousand years of the Early Bronze Age (end of 4th–end of 3rd millennium BCE) the same unalloyed copper production of the Chalcolithic (group 2, above) continued for the production of short blades and points. The same metal technique was used for the novel production of long blade weapons (riveted daggers and knives, heavy tanged swords, and epsilon-shaped axes). The same copper production technique of casting into an open mould and then hammering and annealing, was used to produce all other metals as well, including jewelry of thin plates, sometimes decorated, and elongated thin wires (mainly for rings and bracelets) made of unalloyed copper as well as from silver (first appearance) and gold. Archaeological remains of Early Bronze copper mining and copper smelting in the vicinity of the mines were found in Trans-Jordan (Feinan), the Arava Valley (Timnah), and southern Sinai.
|
|
Paired-end tags (PET) (sometimes "Paired-End diTags", or simply "ditags") are the short sequences at the 5’ and 3’ ends of a DNA fragment which are unique enough that they (theoretically) exist together only once in a genome, therefore making the sequence of the DNA in between them available upon search (if full-genome sequence data is available) or upon further sequencing (since tag sites are unique enough to serve as primer annealing sites). Paired-end tags (PET) exist in PET libraries with the intervening DNA absent, that is, a PET "represents" a larger fragment of genomic or cDNA by consisting of a short 5' linker sequence, a short 5' sequence tag, a short 3' sequence tag, and a short 3' linker sequence. It was shown conceptually that 13 base pairs are sufficient to map tags uniquely.Fullwood MJ, Wei CL, Liu ET, Ruan Y. 2009.
|
|
The MLD process is applicable for both p- and n-doping of various nanostructured materials, including conventional planar substrates, nanobelts and nanowires, which are fabricated by either the ‘bottom-up’ or ‘top-down’ approaches, making it highly versatile for various applications. In p-type doping of silicon, a covalently anchored monolayer of allylboronic acid pinacol ester is formed on the surface as the boron precursor while a monolayer of diethyl 1-propylphosphonate is used as the phosphorus precursor in n-type doping. For example, in the case of USJ formation, combining the phosphorus-MLD and conventional spike annealing, the record 5 nm junction (down to 2 nm - the SIMS resolution limit) with the noncontact Rs measurements (~5000 Ω/□) is reported and being consistent with the predicted values from the dopant profile. Notably, ~70 % of the dopants are electrically active as the MLD process utilizes an equilibrium based diffusion mechanism.
|
|
This magnetization as a function of the external field is described by a hysteresis curve. Although this state of aligned domains found in a piece of magnetized ferromagnetic material is not a minimal-energy configuration, it is metastable, and can persist for long periods, as shown by samples of magnetite from the sea floor which have maintained their magnetization for millions of years. Heating and then cooling (annealing) a magnetized material, subjecting it to vibration by hammering it, or applying a rapidly oscillating magnetic field from a degaussing coil tends to release the domain walls from their pinned state, and the domain boundaries tend to move back to a lower energy configuration with less external magnetic field, thus demagnetizing the material. Commercial magnets are made of "hard" ferromagnetic or ferrimagnetic materials with very large magnetic anisotropy such as alnico and ferrites, which have a very strong tendency for the magnetization to be pointed along one axis of the crystal, the "easy axis".
|
|
When choosing the candidate generator , one must consider that after a few iterations of the simulated annealing algorithm, the current state is expected to have much lower energy than a random state. Therefore, as a general rule, one should skew the generator towards candidate moves where the energy of the destination state s' is likely to be similar to that of the current state. This heuristic (which is the main principle of the Metropolis–Hastings algorithm) tends to exclude "very good" candidate moves as well as "very bad" ones; however, the former are usually much less common than the latter, so the heuristic is generally quite effective. In the traveling salesman problem above, for example, swapping two consecutive cities in a low-energy tour is expected to have a modest effect on its energy (length); whereas swapping two arbitrary cities is far more likely to increase its length than to decrease it.
|
|
This complex was built in 1934 by Donald B. McLouth, a Detroit scrap dealer, as a small conversion mill on Livernois Avenue in Detroit, MI. Desiring additional options for steel, partial financing was provided by General Motors. In its later years, the plant was revamped to produce only stainless steel, eventually being bought by Jones and Laughlin Steel Company in 1981. The Detroit mill initially consisted of a small reversing hot rolling strip mill with a slab heating furnace. The original hot strip mill was known as the "Coffee Grinder" from the sounds the mill would make. In 1938, the company brought online a single 4-high reversing cold reducing mill with ancillary facilities (annealing and finishing). Throughout the next few years, modifications were made to the equipment and eventually, the company had the capacity to roll 108,000 net tons per year of hot rolled products and 60,000 net tons of cold rolled steel products.
|
|
Diamond enhancements are specific treatments, performed on natural diamonds (usually those already cut and polished into gems), which are designed to improve the visual gemological characteristics of the diamond in one or more ways. These include clarity treatments such as laser drilling to remove black carbon inclusions, fracture filling to make small internal cracks less visible, color irradiation and annealing treatments to make yellow and brown diamonds a vibrant fancy color such as vivid yellow, blue, or pink. The CIBJO and government agencies such as the United States Federal Trade Commission explicitly require the disclosure of all diamond treatments at the time of sale. Some treatments, particularly those applied to clarity, remain highly controversial within the industry—this arises from the traditional notion that diamonds hold a unique or "sacred" place among the gemstones, and should not be treated too radically, if for no other reason than a fear of damaging consumer confidence.
|
|
Evidence suggests that gold and meteoric iron (but not smelted iron) were the only metals used by humans before copper. The history of copper metallurgy is thought to follow this sequence: First, cold working of native copper, then annealing, smelting, and, finally, lost-wax casting. In southeastern Anatolia, all four of these techniques appear more or less simultaneously at the beginning of the Neolithic c. 7500 BC. Copper smelting was independently invented in different places. It was probably discovered in China before 2800 BC, in Central America around 600 AD, and in West Africa about the 9th or 10th century AD. Investment casting was invented in 4500–4000 BC in Southeast Asia and carbon dating has established mining at Alderley Edge in Cheshire, UK, at 2280 to 1890 BC. Ötzi the Iceman, a male dated from 3300 to 3200 BC, was found with an axe with a copper head 99.7% pure; high levels of arsenic in his hair suggest an involvement in copper smelting.
|
|
This limitation is meaningless for 'read-only' applications such as thin clients and routers, which are programmed only once or at most a few times during their lifetimes. In December 2012, Taiwanese engineers from Macronix revealed their intention to announce at the 2012 IEEE International Electron Devices Meeting that they had figured out how to improve NAND flash storage read/write cycles from 10,000 to 100 million cycles using a "self-healing" process that used a flash chip with "onboard heaters that could anneal small groups of memory cells." The built-in thermal annealing was to replace the usual erase cycle with a local high temperature process that not only erased the stored charge, but also repaired the electron-induced stress in the chip, giving write cycles of at least 100 million. The result was to be a chip that could be erased and rewritten over and over, even when it should theoretically break down.
|
|
In 1981, a large number of 20-cent coins were required, far more than the capacity of the Royal Australian Mint facility in Canberra, leading to some coins being minted at other facilities. The Canadian impression of the 20-cent coin is known as the "Ottawa Mint" version, which may be misleading as, post 1976, the Ottawa Mint only produced precious metal commemorative coins, like the Perth Mint, meaning the coins may have been produced at the Royal Canadian Mint's Winnipeg facilities. Due to differences in the milling and annealing process, the Canadian variety of the 1981 20-cent coin is distinctive to attentive collectors and even cash handlers. The top and bottom edges of the milling is rounded over, not squared like the Australian and London varieties, and despite being in circulation for well over 25 years, even when well worn, the fields remain shiny, and not dulled like those produced at other mints.
|
|
Unworked copper nugget The native copper, as well as the technique of cold working it, is believed to have come from the Great Lakes area, hundreds of miles to the north of the Cahokia polity and most other Mississippian culture sites, although the copper workshops discovered near Mound 34 at Cahokia are so far the only copper workshops found at a Mississippian culture archaeological site. Researchers at Northwestern's School of Engineering and Applied Science used an electron microscope to analyze pieces of the flat copper sheets found during excavations at the Mound 34 site at Cahokia. The researchers found that the metal had been repeatedly heated and cooled and while it was softened by the heat, had been hammered, a process known as annealing, similar to how blacksmiths work iron. They were also able to determine that the Cahokian coppersmiths had heated the copper in a wood fire to produce sufficient heat for this process.
|
|
What is needed is a form of heat treatment called differential hardening, where heat is carefully applied to part of the case until the desired softness is reached, and then the heat treatment process is halted by rapidly cooling the case. Since annealing brass requires heating it to about 660 °F (350 °C), the heating must be done in such a way as to heat the neck to that temperature, while preventing the base of the case from being heated and losing its hardness. The traditional way is to stand the cases in a shallow pan full of water, then heat the necks of the cases with a torch, but this method makes it difficult to get an even heating of the entire case neck. A temperature-sensitive crayon can be used at the point to which it is to be annealed, which is just behind the shoulder for bottlenecked cartridges, or at the bottom of the bullet seating depth for straight-wall cartridges.
|
|
The simplest training algorithm for vector quantization is: # Pick a sample point at random # Move the nearest quantization vector centroid towards this sample point, by a small fraction of the distance # Repeat A more sophisticated algorithm reduces the bias in the density matching estimation, and ensures that all points are used, by including an extra sensitivity parameter : # Increase each centroid's sensitivity s_i by a small amount # Pick a sample point P at random # For each quantization vector centroid c_i, let d(P, c_i) denote the distance of P and c_i # Find the centroid c_i for which d(P, c_i) - s_i is the smallest # Move c_i towards P by a small fraction of the distance # Set s_i to zero # Repeat It is desirable to use a cooling schedule to produce convergence: see Simulated annealing. Another (simpler) method is LBG which is based on K-Means. The algorithm can be iteratively updated with 'live' data, rather than by picking random points from a data set, but this will introduce some bias if the data are temporally correlated over many samples.
|
|
All well-established techniques of carbon nanotube growth, such as arc- discharge, laser ablation and chemical vapor deposition, are used for mass- production of BN nanotubes at a tens of grams scale. BN nanotubes can also be produced by ball milling of amorphous boron, mixed with a catalyst (iron powder), under NH3 atmosphere. Subsequent annealing at ~1100 °C in nitrogen flow transforms most of the product into BN. A high-temperature high-pressure method is also suitable for BN nanotube synthesis. BNNT production route has been a significant issue due to low yield and poor quality in comparison with CNT, thus limiting its practical uses. However, many great successes in BNNT synthesis have been achieved in recent years, enabling access to this material and paving the way for the development of promising applications Recently significant advancement have been made by Deakin University Australia with a ‘novel and scalable’ manufacturing process will allow the production of BNNTs in large quantities for the first time since the material was first discovered two decades ago.
|
|
On the early morning of 6 December 2007, an accident on the annealing and pickling line of the ThyssenKrupp plant in Turin, Italy, caused the death of seven steelworkers.The Thyssen Krupp Accident in Torino: Investigation Methods, Accident Dynamics and Lesson Learned 2012, p 615-620 The accident happened between 00:45 and 00:48, when the eight workers that were then on duty attempted to extinguish a localized small pool fire with CO2 fire extinguishers and a fire hydrant, without success. Roughly 400L of hydraulic oil escaped during the rupture of a hydraulic circuit that caused a violent jet fire and engulfed the workers that were fighting the fire. CEO Espenhahn has been charged by the State prosecutor of Turin with "voluntary multiple murder with eventual malice" ("omicidio volontario multiplo con dolo eventuale"), while five other managers and executives have been charged with "culpable murder with conscious guilt". On Friday 15 April 2011, Espenhahn and all the other indictees were pronounced guilty of all charges; Espenhahn has been sentenced to 16 years and 6 months in jail and to a lifelong ban from holding public office.
|
|
Horz & Kallfass 1998, p. 10 To make the artifacts, copper ingots were hammered into sheet metal and formed into the desired shape (e.g. a mask). While the exact method for adding the gold film to the outside is not known, one well-accepted theory is that gold was likely dissolved in aqueous solutions of corrosive compounds recovered from the Northern Peruvian deserts and brought to a low boil, after which the copper sheet was dipped in resulting in the reaction: : 2Au3+ \+ 3Cu ⇌ 2Au0 \+ 3Cu2+ thereby dissolving copper and depositing gold on the surface of the metal. The sheet is then heated to between 500 and 800oC, allowing the gold film to permanently bond to the surface. These gold films were not pure gold, but have been found to be of gold-copper-silver solutions (ex. Cu28Au2Ag).Horz & Kallfass 1998, p. 11Lechtman 1988 Some of the silver artifacts (namely individually made head-shaped beads, about 4.0 cm by 5.1 cm) were formed by alternating between hammering and annealing copper-silver alloy (Cu18Ag1Au) resulting in copper-oxide forming along the surface which can be removed using an acid (plant juices) or base (stale urine that has turned to ammonia).
|
|
Labino initially advised Littleton about the type of fire bricks to use in the construction of the furnace for the workshop. Labino also donated the steel and burner for the furnace, while Littleton brought the bricks from his studio in Wisconsin.Lynn, 2004 p. 55 Thus the stage was set for the seminal event of the Studio Glass Movement. The workshop, which began on March 23, did not start out smoothly. Labino's glassblowing workshop in 1968, with his chair and marvering board, annealing kiln (left), and glass furnaces (right). The first glass batch did not melt properly, and the stoneware crucible that Littleton had made to hold the molten glass in the furnace broke apart in the intense heat. Labino suggested that they melt the glass directly in the furnace;Lynn, 2001 p. 55 he then directed the conversion of the pot furnace into a small day tank. Instead of trying to melt another load of glass batch, Labino re-charged the furnace with the low-melting formula #475 glass marbles that he had developed for Johns-Manville for the production of fiberglass. The marbles, which melted at a relatively low temperature, produced glass that was malleable enough to blow.
|
|
Like dead-end elimination, the SCMF method explores conformational space by discretizing the dihedral angles of each side chain into a set of rotamers for each position in the protein sequence. The method iteratively develops a probabilistic description of the relative population of each possible rotamer at each position, and the probability of a given structure is defined as a function of the probabilities of its individual rotamer components. The basic requirements for an effective SCMF implementation are: # A well-defined finite set of discrete independent variables # A precomputed numerical value (considered the "energy") associated with each element in the set of variables, and associated with each binary element pair # An initial probability distribution describing the starting population of each individual rotamer # A way of updating rotamer energies and probabilities as a function of the mean-field energy The process is generally initialized with a uniform probability distribution over the rotamers — that is, if there are p rotamers at the kth position in the protein, then the probability of any individual rotamer r_{k}^{A} is 1/p. The conversion between energies and probabilities is generally accomplished via the Boltzmann distribution, which introduces a temperature factor (thus making the method amenable to simulated annealing).
|
|