1000 Sentences With "conjugated" | Random Sentence Generator

Unfortunately for them, Le Monde noted, the students incorrectly conjugated the verb "to authorize," misspelling the word.

Rifaat loved neologisms like yeshayar , which took the "share" from Facebook and conjugated it as an Arabic verb.

The discourse went down on Twitter (obviously), though Jenkins didn't stand by his poorly conjugated statements and later deleted them.

Conjugated pairs of proteins and sugars are much more visible to infants' immature immune systems and help them generate protective antibodies.

The team began with a conjugated plasmid — a small packet of genetic material that can replicate itself and be passed from one bacterium to the next.

Vaginal estrogen, which is available as either estradiol or conjugated equine estrogens, are considered the gold standard to replace the estrogen your body is no longer making after menopause.

They need to know, at the very least, how the verbs are conjugated, whether the nouns change depending on their function in the sentence, and what the sound system is.

Decorum is observed — grace is said before meals; corsets are tightened; French verbs are conjugated; everyone is called "miss" — but under the surface all kinds of strong emotions seethe and simmer.

Some conjugated fatty acids may confer health benefits ranging from the prevention of hypertension to protection against certain forms of cancer, although more research is needed to confirm such effects. Conjugated fatty acids have different groups, and one of them is the conjugated linoleic acid isomers. Conjugated linoleic acids are the most investigated conjugated fatty acids. The reason why the isomer of conjugated fatty acids are studied is because they have the potential to treat human illnesses.

Conjugated fatty acids can have either a cis or trans configuration. For instance, the rumenic acid (cis9, trans11) is a conjugated trans fatty acid.

Estrogens, conjugated is the generic name of the drug and its and . It is also known as conjugated estrogens or as conjugated equine estrogens. The brand name Premarin is a contraction of "pregnant mares' urine". CEEs are marketed under a large number of brand names throughout the world.

Thus, an abnormal rise in both unconjugated and conjugated bilirubin will be present. Because excretion (the rate-limiting step) is usually impaired to the greatest extent, conjugated hyperbilirubinemia predominates. The unconjugated bilirubin still enters the liver cells and becomes conjugated in the usual way. This conjugated bilirubin is then returned to the blood, probably by rupture of the congested bile canaliculi and direct emptying of the bile into the lymph leaving the liver.

Post-hepatic jaundice (obstructive jaundice) is due to a blockage of bile excretion from the biliary tract → increased conjugated bilirubin and bile salts. In complete obstruction of the bile duct, conjugated bilirubin cannot access the intestinal tract → no further bilirubin conversion to urobilinogen → no stercobilin or urobilin. Instead, excess conjugated bilirubin is filtered into the urine without urobilinogen in obstructive jaundice. Conjugated bilirubin in urine (bilirubinuria) gives urine an abnormally dark brown color.

The structure of a conjugated enyne An enyne is an organic compound consisting of a double bond (alkene) and triple bond (alkyne). It is called a conjugated enyne when the double and triple bonds are conjugated. The term is a contraction of the terms alkene and alkyne. The simplest enyne is vinylacetylene.

Although the terms direct and indirect bilirubin are used equivalently with conjugated and unconjugated bilirubin, this is not quantitatively correct, because the direct fraction includes both conjugated bilirubin and δ bilirubin. Delta bilirubin is albumin-bound conjugated bilirubin. In the other words, delta bilirubin is the kind of bilirubin covalently bound to albumin, which appears in the serum when hepatic excretion of conjugated bilirubin is impaired in patients with hepatobiliary disease. Furthermore, direct bilirubin tends to overestimate conjugated bilirubin levels due to unconjugated bilirubin that has reacted with diazosulfanilic acid, leading to increased azobilirubin levels (and increased direct bilirubin).

Cinnamaldehyde is a naturally-occurring compound that has a conjugated system penta-1,3-diene is a molecule with a conjugated system Diazomethane conjugated pi-system In chemistry, a conjugated system is a system of connected p orbitals with delocalized electrons in a molecule, which in general lowers the overall energy of the molecule and increases stability. It is conventionally represented as having alternating single and multiple bonds. Lone pairs, radicals or carbenium ions may be part of the system, which may be cyclic, acyclic, linear or mixed. The term "conjugated" was coined in 1899 by the German chemist Johannes Thiele.

Rumenic acid, an example of conjugated linoleic acid Conjugated linoleic acids (CLA) are a family of at least 28 isomers of linoleic acid found mostly in the meat and dairy products derived from ruminants. Their two double bonds are conjugated (i.e., separated by a single bond). CLAs can be either cis-fats or trans-fats.

Dienes can be divided into three classes, depending on the relative location of the double bonds: #Cumulated dienes have the double bonds sharing a common atom. The result is more specifically called an allene. #Conjugated dienes have conjugated double bonds separated by one single bond. Conjugated dienes are more stable than other dienes because of resonance.

This structure is conjugated as ṛāhū + Verb in the present tense.

Bazedoxifene is marketed both alone and in combination with conjugated estrogens.

Annulenes, completely conjugated monocyclic hydrocarbons, may be aromatic, nonaromatic or antiaromatic.

Rotor syndrome (also known as Rotor type hyperbilirubinemia) is a rare cause of mixed direct (conjugated) and indirect (unconjugated) hyperbilirubinemia, relatively benign, autosomal recessive bilirubin disorder characterized by non-hemolytic jaundice due to the chronic elevation of predominantly conjugated bilirubin. Rotor type hyperbilirubinemia is a distinct yet similar disorder to Dubin–Johnson syndrome – both diseases cause an increase in conjugated bilirubin. Whereas rotor syndrome differs in that it is a result of impaired hepatocellular storage of conjugated bilirubin that leaks into plasma causing hyperbilirubinemia.

Thus, most of the bilirubin in the plasma becomes the conjugated type rather than the unconjugated type, and this conjugated bilirubin, which did not go to intestine to become urobilinogen, gives the urine the dark color.

Once unconjugated bilirubin arrives in the liver, a liver enzyme UDP-glucuronyl transferase conjugates bilirubin + glucuronic acid → bilirubin diglucuronide (conjugated bilirubin). Bilirubin that has been conjugated by the liver is water-soluble and excreted into the gallbladder.

Verbs are either weak or strong. This decides how they are conjugated.

There are finite (conjugated) and non-finite verbs. There are several conjugations.

A biological activity that conjugated fatty acids have been studied for is the reduction of body fat and the increasing of lean body mass. There are experimental models that proved the ability of conjugated linoleic acid to reduce fat levels. This is why the scientific community see the potential to use conjugated fatty acids with active treatments to prevent obesity. However, research studies made in humans are in disagreement even though these studies have proven that the supplementation of conjugated linoleic acid has some benefits such as weight loss.

Much like conductive metals, conjugated polymers exhibit electronic bands. The electrons of the conjugated system occupy the valence band and removal of electrons from this band or addition of electrons to the higher energy conductive band can lead to conductivity. Conjugated materials can in many cases absorb visible light because of their delocalized π-system. These properties have led to applications in organic electronics and organic photonics.

This technique also offers a selective and soft ionization for highly conjugated compounds.

Phytoene is a symmetric molecule containing three conjugated double bonds. Phytoene has a UV-Vis absorption spectrum typical for a triply conjugated system with its main absorption maximum in the UVB range at 286 nm and with ε1% of 915.

In general, two mechanisms have been suggested. Because Jacobsen’s catalyst epoxidizes conjugated alkenes (i.e. those in which there are multiple double bonds on alternating carbons) most effectively, the generally accepted mechanism is based on a radical intermediate which is stabilized due to the conjugated nature of the substrate. For non-conjugated alkenes, the substrate is far less able to stabilize a radical, making a radical intermediate more unlikely.

The largest conjugated systems are found in graphene, graphite, conductive polymers and carbon nanotubes.

Conjugated estriol, sold under the brand names Progynon and Emmenin, is an estrogen medication which was previously used for estrogen-type indications such as the treatment of menopausal symptoms in women. The term specifically refers to formulations of estriol conjugates which were manufactured from the estrogen-rich urine of pregnant women and were used as medications in the 1920s and 1930s. Conjugated estriol is analogous to and was superseded by conjugated estrogens (brand name Premarin), which is manufactured from the urine of pregnant mares. Conjugated estriol was among the first forms of pharmaceutical estrogen to be used in medicine.

Along the proximal and distal ileum, these conjugated primary bile salts are reabsorbed actively into hepatic portal circulation. Bacteria deconjugate some of the primary and secondary conjugated bile salts back to lipid-soluble bile acids, which are passively absorbed into hepatic portal circulation.

In collaborative and interdisciplinary projects Rabe contributed to the development of advanced functional materials, including dendronized and conjugated polymers, multivalent biopolymer complexes, ultrathin films of conjugated molecules, supramolecular polymers and helical nanofilaments, nanographenes, and 2D materials as well as mixed 2D/3D heterostructures.

Urine bilirubin may also be clinically significant. Bilirubin is not normally detectable in the urine of healthy people. If the blood level of conjugated bilirubin becomes elevated, e.g. due to liver disease, excess conjugated bilirubin is excreted in the urine, indicating a pathological process.

Common for molecules used in molecular electronics is that the structures contain many alternating double and single bonds (see also Conjugated system). This is done because such patterns delocalize the molecular orbitals, making it possible for electrons to move freely over the conjugated area.

Sentence-final particles are used to add emotional or emphatic impact, or make questions. Nouns have no grammatical number or gender, and there are no articles. Verbs are conjugated, primarily for tense and voice, but not person. Japanese equivalents of adjectives are also conjugated.

There are three conjugation classes in Latvian. Verbs are conjugated for person, tense, mood and voice.

On the basis of their chemical nature tumor markers can be proteins, conjugated proteins, peptides and carbohydrates. Proteins or conjugated proteins may be enzymes, hormones or fragments of proteins. Sequencing of genes for diagnostic purposes is mostly classified under the biomarker heading and is not discussed here.

Many of the words where it is possible to choose gender are inanimate objects that one might suspect would be conjugated with the neuter gender. Nouns conjugated with the neuter gender cannot normally be conjugated as feminine or masculine in Norwegian. There is also a slight tendency towards using the masculine indefinite article even when choosing the feminine conjugation of a noun in many eastern Norwegian dialects. For instance, word for "girl" is declined: "En jente, jenta, jenter, jentene".

Bilirubin is conjugated with glucuronic acid in the liver by the enzyme glucuronyltransferase, making it soluble in water. Much of it goes into the bile and thus out into the small intestine. Although 95% of the secreted bilirubinoid bile is reabsorbed by the small intestine, conjugated bilirubin is not reabsorbed in small intestine. All conjugated bilirubin in the large intestine is metabolised by colonic bacteria to urobilinogen, which is then further oxidized to urobilin and stercobilin.

Rumenic acid, one of the 28 conjugated isomers of linoleic acid Conjugated fatty acids are polyunsaturated fatty acids in which at least one pair of double bonds is separated by only one single bond. The conjugation implies four consecutive unsaturated links (i.e., CH rather than CH2 groups), and results in a delocalization of electrons along the double-bonded carbons. An example of a conjugated fatty acid is the rumenic acid, found in the meat and milk of ruminants.

In Wolof, verbs are unchangeable stems that cannot be conjugated. To express different tenses or aspects of an action, personal pronouns are conjugated – not the verbs. Therefore, the term temporal pronoun has become established for this part of speech. It is also referred to as a focus form.

For full details of how verbs are conjugated in Finnish, please refer to the Finnish verb conjugation article.

Miltenyi sells microbeads which are magnetic nanoparticles conjugated to antibodies which can be used to target specific cells.

Pentacene.Polymers Oligomers and polymers based on pentacene have been explored both synthetically as well as in device application settings. Polymer light emitting diodes (PLEDs) have been constructed using conjugated copolymers (1a–b) containing fluorene and pentacene. A few other conjugated pentacene polymers (2a–b and 3) have been realized based on Sonogashira and Suzuki coupling reactions of a dibromopentacene monomer. Non-conjugated pentacene- based polymers have been synthesized via esterification of a pentacene diol monomer with bis-acid chlorides to form polymers 4a–b. OLIGOMERS Various synthetic strategies have been employed to form conjugated oligomers of pentacene 5a–c including a one-pot-four-bond forming procedure which provided a solution-processable conjugated pentacene dimer (5c) which exhibited photoconductive gain >10, placing its performance within the same order of magnitude as thermally evaporated films of non-functionalized pentacene which exhibited photoconductive gain >16 using analogous measurement techniques.

PIDA, monomer, and host scaffolds used. Applications utilizing properties of conjugated polymers emerged from work done by Heeger, McDiaramid, and Shirakawa with the discovery that polyacetylene is a conducting, albeit difficult to process material. Since then, work has been done to mimic this conjugated polymer’s backbone (e.g., poly(p-phenylenevinylene)).

Ibanag verbs are not conjugated in the same manner that most Indo- European languages are. They are conjugated based on the tense of the word. As with many other Malayo-Polynesian languages, there is no verb for "to be". However this is sometimes compensated by using the verb for "to have".

Dimer fatty acids are produced from different fatty acids by heating. Necessary are a fatty acid with conjugated double bonds or other unsaturated fatty acids. Examples of such fatty acids are conjugated linoleic acids. The reaction is carried out via Diels-Alder addition, whereby a partially unsaturated C6 ring is formed.

The most substantial increase in stiffness is observed in PEG-Fibrinogen conjugated hydrogel after 28 days of mechanical stimulation.

Coupling reactions are routinely employed in the preparation of pharmaceuticals. Conjugated polymers are prepared using this technology as well.

If we have high levels of bilirubin in the blood, the Van den Bergh chemical reaction is used to determine if the bilirubin is conjugated or unconjugated. Azobilirubin can also be used to determine how much conjugated bilirubin is the blood compared to that of unconjugated bilirubin. This process is done by using both forms of bilirubin alongside a diazo reagent and a caffeine-benzoate reagent. Conjugated bilirubin with the azo reagent will react, whilst the unconjugated bilirubin will not react with the azo reagent.

Thompson also abandoned the Gresley conjugated valve gear and instead fitted independent sets of Walschaerts valve gear to each cylinder.

Microcystin-LR is known to be excreted as glutathione conjugate, cysteine conjugate and an oxidized ADDA diene conjugate. The glutathione and cysteine conjugate with the Mda-moiety. The oxidized ADDA is conjugated at the conjugated bond.Kondo, F., Matsumoto, H., Yamada, S., Ishikawa, N., Ito, E., Nagata, S., Ueno, Y.,Suzuki, M. and Harada, K.-I.

In the liver, bilirubin is conjugated with glucuronic acid by the enzyme glucuronyltransferase, making it soluble in water: the conjugated version is the main form of bilirubin present in the "direct" bilirubin fraction. Much of it goes into the bile and thus out into the small intestine. Though most bile acid is reabsorbed in the terminal ileum to participate in enterohepatic circulation, conjugated bilirubin is not absorbed and instead passes into the colon. There, colonic bacteria deconjugate and metabolize the bilirubin into colorless urobilinogen, which can be oxidized to form urobilin and stercobilin.

In the presence of an alkyl halide the carbanion can also undergo nucleophilic substitution with carbon-carbon bond formation. In substituted aromatic compounds an electron-withdrawing substituent, such as a carboxylic acid, stabilizes a carbanion and the least-substituted olefin is generated. With an electron- donating substituent the opposite effect is obtained. The reaction produces more of the less thermodynamically stable non-conjugated 1,4-addition product than the more stable conjugated 1,3-diene because the largest orbital coefficient of the HOMO of the conjugated pentadienyl anion intermediate is on the central carbon atom.

Conjugated microporous polymers (CMPs) are a sub-class of porous materials that are related to structures such as zeolites, metal-organic frameworks, and covalent organic frameworks, but are amorphous in nature, rather than crystalline. CMPs are also a sub-class of conjugated polymers and possess many of the same properties such as conductivity, mechanical rigidity, and insolubility. CMPs are created through the linking of building blocks in a π-conjugated fashion and possess 3-D networks. Conjugation extends through the system of CMPs and lends conductive properties to CMPs.

Estetrol is metabolized minimally, if at all. It is conjugated via glucuronidation and to a lesser extent sulfation and then excreted.

This effect results from the ability of the electrons in conjugated bonds to delocalize, or spread their effect throughout the molecule.

Conjugated polymers have many practical applications, and are used in devices such as photovoltaic cells, organic light-emitting diodes, field-effect transistors, and chemical sensors. Goroff et al. prepared ordered poly(diiododiacetylene) (PIDA) via prearrangement of monomer (2) with a halogen bond scaffolding. PIDA is an excellent precursor to other conjugated polymers, as Iodine can be easily transformed.

In medicine, bilirubinuria is an abnormality in which conjugated bilirubin is detected in the urine.bilirubinuria at eMedicine Dictionary The term "biliuria" is very similar, but more general. It refers to the presence of any bile pigment in the urine. Conjugated bilirubin is detected in urine at bilirubinemia of approximately 30-34 mmol/l or 20 mg/dL.

Neonatal cholestasis defines persisting conjugated hyperbilirubinemia in the newborn with conjugated bilirubin levels exceeding 15% (5.0 mg/dL) of total bilirubin level. The disease is either due to defects in bile excretion from hepatocytes or impaired bile flow.General presentations in neonates include abdominal pain and general GI upset. Physical examination may show palpable liver and enlarged spleen.

This constitutes the normal "enterohepatic urobilinogen cycle." In biliary obstruction, below-normal amounts of conjugated bilirubin reach the intestine for conversion to urobilinogen. With limited urobilinogen available for reabsorption and excretion, the amount of urobilin found in the urine is low. High amounts of the soluble conjugated bilirubin enter the circulation where they are excreted via the kidneys.

Types of Dendrimer. (1.) Encapsulation Interaction (2.) Conjugated Interaction Dendrimers in drug- delivery systems is an example of various host–guest interactions. The interaction between host and guest, the dendrimer and the drug, respectively, can either be hydrophobic or covalent. Hydrophobic interaction between host and guest is considered "encapsulated," while covalent interactions are considered to be conjugated.

Hückel's rule is not valid for many compounds containing more than one ring. For example, pyrene and trans-bicalicene contain 16 conjugated electrons (8 bonds), and coronene contains 24 conjugated electrons (12 bonds). Both of these polycyclic molecules are aromatic, even though they fail the 4n + 2 rule. Indeed, Hückel's rule can only be theoretically justified for monocyclic systems.

Kayser, L. V.; Vollmer, M.; Welnhofer, M.; Krikcziokat, H.; Meerholz, K.; Arndtsen, B. A., Metal-Free, Multicomponent Synthesis of Pyrrole-Based pi-Conjugated Polymers from Imines, Acid Chlorides, and Alkynes. J. Am. Chem. Soc. 2016, 138, 10516. () Kayser, L. V.; Hartigan, E. M.; Arndtsen, B. A., Multicomponent Coupling Approach to Cross-Conjugated Polymers from Vanillin-Based Monomers.

The encoded protein is linked with a ubiquitin-like protein, NEDD8, which can be conjugated to cellular proteins, such as Cdc53/culin.

Park, Yeonhwa "Conjugated linoleic acid (CLA): Good or bad trans fat?" Journal of Food Composition and Analysis 2009, vol. 22, S4-S12.

So by using a fluorescence microscope, the organic dye-conjugated CQDs were able to visualize changes in physiologically relevant levels of H2S.

Medrogestone is or has been marketed under the brand names Ayerluton, Colpro, Colpron, Colprone, Etogyn, Prothil, and, in combination with conjugated estrogens, Presomen.

In addition, methyl bromoacetate also use in synthesize of coumarins and cis- cyclopropane. It reacts with conjugated base and produce alkylated carbene complexes.

This led to the development of combined estrogen–progestogen therapy, most commonly with a combination of conjugated equine estrogen (Premarin) and medroxyprogesterone (Provera).

Immunoliposomes are antibody-conjugated liposomes. Liposomes can carry drugs or therapeutic nucleotides and when conjugated with monoclonal antibodies, may be directed against malignant cells. Immunoliposomes have been successfully used in vivo to convey tumour- suppressing genes into tumours, using an antibody fragment against the human transferrin receptor. Tissue-specific gene delivery using immunoliposomes has been achieved in brain and breast cancer tissue.

Cholesterol is oxidized by the liver into a variety of bile acids. These, in turn, are conjugated with glycine, taurine, glucuronic acid, or sulfate. A mixture of conjugated and nonconjugated bile acids, along with cholesterol itself, is excreted from the liver into the bile. Approximately 95% of the bile acids are reabsorbed from the intestines, and the remainder are lost in the feces.

Thus, the magnitude of destabilization via the allyic strain outweighs the stabilization caused by the conjugated system. Molecule A undergoes cyclization after treatment with perchloric acid. Due to the allylic strain in molecule B, the molecule was found not to exhibit conjugation stabilization and was stabilized in the formation shown in C. Thus, allylic strain outweighs the stabilization effects of a conjugated system.

Citrinin is a planar molecule which contains conjugated bonds. As a result of these conjugated bonds citrinin is autofluorescent. Citrinin crystals can hardly be dissolved in cold water, however in polar organic solvents and aqueous sodium hydroxide, sodium carbonate and sodium acetate dissolving is possible. As stated above, citrinin decomposes at temperatures higher than 175 °C, providing that it is under dry conditions.

These modified compounds are then conjugated to polar compounds in phase II reactions. These reactions are catalysed by transferase enzymes such as glutathione S-transferases. Finally, in phase III, the conjugated xenobiotics may be further processed, before being recognised by efflux transporters and pumped out of cells. Drug metabolism often converts lipophilic compounds into hydrophilic products that are more readily excreted.

The addition of DNA to the surface of a quantum dot changes the intermolecular forces that occur between un-conjugated quantum dots. Changing the intermolecular forces between the quantum dots can alter many characteristics important for the use of quantum dots in aqueous conditions. As the surface of quantum dots are conjugated with DNA, the colloidal stability and solubility are affected.

Bazedoxifene is marketed alone under the brand names Conbriza and Viviant and in combination with conjugated estrogens under the brand names Duavee and Duavive.

Verbs in Northern Bavarian are conjugated for person, tense and mood. The Northern Bavarian verbs are also subject to both vowel change and apophony.

Several different mutations in this gene have been observed in patients with Dubin–Johnson syndrome (DJS), an autosomal recessive disorder characterized by conjugated hyperbilirubinemia.

Milnacipran is conjugated to the inactive glucuronide and excreted in the urine as unchanged drug and conjugate. Only traces of active metabolites are found.

Euglenophycin is composed of piperidine ring with two side-chains, one of which has a conjugated system giving it an absorbance at 238 nm.

A close set of words (diversely conjugated and pronounced) in Old English is (f)irst(en), the meaning of which is as at present, first.

Davis is the developer of a constructed language called Is. Among its unique characteristics are that words are "conjugated in altitudes," or levels of consciousness.

PhD Thesis, Linköping University, Sweden. His research interests are in polymer optoelectronics and bioelectronics, conjugated polymer physics and polymer electrochemistry.Research interests of Prof. Inganäs's group.

Conjugated estrogens/norgestrel (CEEs/NG), sold under the brand name Prempak-C among others, is a combination of conjugated estrogens (CEEs), an estrogen, and norgestrel (NG), a progestin, which is used in menopausal hormone therapy in postmenopausal women. It is taken by mouth and contains 0.625 or 1.25 mg CEEs and 150 μg NG (or 75 μg levonorgestrel) per tablet. The medication is no longer marketed.

Each aspect has a past form and a non-past form. The non-past verb forms are conjugated by person/number, while the past verb forms are conjugated by gender/number. The present tense is indicated with the non-past imperfective form. The future in the perfective aspect is expressed by applying the conjugation of the present form to the perfective version of the verb.

Phytofluene is a colorless carotenoid found naturally in tomatoes and other vegetables. It is the second product of carotenoid biosynthesis.Tomato Metabolite Database, Cornell University It is formed from phytoene in a desaturation reaction leading to the formation of five conjugated double bonds. In the following step, addition of carbon-carbon conjugated double bonds leads to the formation of z-carotene and appearance of visible color.

CyTOF mass cytometer. Mass cytometry is a mass spectrometry technique based on inductively coupled plasma mass spectrometry and time of flight mass spectrometry used for the determination of the properties of cells (cytometry). In this approach, antibodies are conjugated with isotopically pure elements, and these antibodies are used to label cellular proteins. Cells are nebulized and sent through an argon plasma, which ionizes the metal- conjugated antibodies.

Chenodeoxycholic acid is synthesized in the liver from cholesterol via several enzymatic steps. Like other bile acids, it can be conjugated with taurine or glycine, forming taurochenodeoxycholate or glycochenodeoxycholate. Conjugation results in a lower pKa. This results in the conjugated bile acids being ionized at the usual pH in the intestine, and staying in the gastrointestinal tract until reaching the ileum to be reabsorbed.

68Ga DOTA conjugated peptides (including 68Ga DOTATATE, DOTATOC and DOTANOC) are used for PET imaging of neuroendocrine tumours (NETs). The scan is similar to the SPECT octreotide scan in that a somatostatin analogue is used, and there are similar indications and uses, however image quality is significantly improved. Somatostatin receptors are overexpressed in many NETs, so that the 68Ga DOTA conjugated peptide is preferentially taken up in these locations, and visualised on the scan. As well as diagnosis and staging of NETs, 68Ga DOTA conjugated peptide imaging may be used for planning and dosimetry in preparation for lutetium-177 or yttrium-90 DOTA therapy.

In 1909, he patented a form of conjugated valve gear to drive the valves of a three- cylinder engine from only two sets of valve gear.

"Oye Mi Canto" literally translates to "Hear My Song" in English. Oye is the conjugated (for second person imperative) form of the infinitive oír (to hear).

The drug Premarin is a conjugated estrogen which is commonly used as a hormone replacement therapy. The drug is derived from the urine of pregnant horses.

Carboxyhemoglobin can be infused to deliver CO. The most common approaches are based on polyethylene glycol (PEG)-lyated bovine carboxyhemoglobin and maleimide PEG conjugated human carboxyhemoglobin.

Laboratory findings include severe anemia, normal MCV (means corpuscular value) , and hyperbilirubinemia (from increased red cell destruction) that can be of the conjugated or unconjugated type.

Like benzene and other monocyclic aromatic molecules, polycyclics have a cyclic conjugated pi system with p-orbital overlap above and below the plane of the ring.

The activated NEDD8 is subsequently transferred to the UbcH12 E2 enzyme, and is then conjugated to specific substrates in the presence of the appropriate E3 ligases.

The Simple Present, is conjugated as follows: First class (infinitive in -à: cantà (to sing) ) I sing.: cànte II sing.: càntet III sing.: cànta I plur.

The Simple Future, is conjugated as follows: First class (infinitive in -à: cantà (to sing) ) I sing.: cantaró II sing.: cantarét III sing.: cantarà I plur.

The hydroxylated metabolites of the PAHs are excreted in human urine both as free hydroxylated metabolites and as hydroxylated metabolites conjugated to glucuronic acid and sulfate.

Hepatocytes metabolize cholesterol to cholic acid and chenodeoxycholic acid. These lipid-soluble bile acids are conjugated (reversibly attached) mainly to glycine or taurine molecules to form water soluble primary conjugated bile acids, sometimes called "bile salts". These bile acids travel to the gall bladder during the interdigestive phase for storage and to the descending part of the duodenum via the common bile duct through the major duodenal papilla during digestion. 95% of the bile acids which are delivered to the duodenum will be recycled by the enterohepatic circulation. Due to the pH of the small intestine, most of the bile acids are ionized and mostly occur as their sodium salts which are then called “primary conjugated bile salts.” In the lower small intestine and colon, bacteria dehydroxylate some of the primary bile salts to form secondary conjugated bile salts (which are still water-soluble).

In this case, an anion sits atop an electron-poor π-system, usually established by the placement of electron-withdrawing substituents on the conjugated molecule Figure 5.

Grimsdale, Andrew C.; Muellen, Klaus "Phenylene-based ladder polymers" in Design and Synthesis of Conjugated Polymers, Edited by Leclerc, Mario; Morin, Jean-Francois 2010. Pp. 227-245.

Immunofluorescence is a technique which uses the highly specific binding of an antibody to its antigen in order to label specific proteins or other molecules within the cell. A sample is treated with a primary antibody specific for the molecule of interest. A fluorophore can be directly conjugated to the primary antibody. Alternatively a secondary antibody, conjugated to a fluorophore, which binds specifically to the first antibody can be used.

When brominated or aminated, these structures can be coupled with epoxies, aldehydes, and bromoaromatics, which enable attachment of these silsesquioxanes to π-conjugated polymers. These methods can use copolymerization techniques, Grignard reagents, and different coupling strategies. There has also been research on the ability of conjugated dendrimer silsesquioxanes to behave as light emitting materials. Though, highly branched substituents tend to have π-π interactions, which hinder high luminescent quantum yield.

A tissue-selective estrogen complex (TSEC) is a combination of an estrogen, such as estradiol or conjugated estrogens, and a selective estrogen receptor modulator (SERM), such as tamoxifen, raloxifene, or bazedoxifene. It is thought to have different tissue pattern of estrogenic and antiestrogenic effects than that of either the estrogen or the SERM alone. An example of a clinically used TSEC is conjugated estrogens/bazedoxifene (brand name Duavee).

Similarly, the hydrogenation of the terminal double bond of 1,4-pentadiene releases 30.1 kcal/mol of heat, while hydrogenation of the terminal double bond of conjugated (E)-1,3-pentadiene releases only 26.5 kcal/mol, implying a very similar value of 3.6 kcal/mol for the stabilization energy. The ~3.5 kcal/mol difference in these heats of hydrogenation can be taken to be the resonance energy of a conjugated diene.

Linoleate has 18 carbons, is contained in many vegetable oils, particularly semi-drying oils, and is a cis-9-cis- 12-di-unsaturated fatty acid. C17H31CO2H, IUPAC organization name (9Z , 12Z)-octadeca- 9,12-dienoic acid, numerical representation 18: 2 (9,12), n-6, molecular weight 280.45, melting point -5 °C, specific gravity 0.902. CAS Registry Number 60-33-3. There is a double bond is conjugated as an isomer conjugated linoleic acid.

CQDs can be used for bioimaging due to their fluorescence emissions and biocompatibility. By injecting solvents containing CQDs into a living body, images in vivo can be obtained for detection or diagnosis purposes. One example is that organic dye-conjugated CQDs could be used as an effective fluorescent probes for H2S. The presence of H2S could tune the blue emission of the organic dye-conjugated CQDs to green.

Bazedoxifene/conjugated estrogens, sold under the brand name Duavee in the US and Duavive in the EU, is a fixed-dose combination medication for the treatment of menopause symptoms and postmenopausal osteoporosis. It contains the selective estrogen receptor modulator bazedoxifene and conjugated estrogens. It is taken by mouth. The combination was approved for medical use in the United States in October 2013, and in the European Union in December 2014.

Magnetic nanoparticles conjugated to an antibody against an antigen of interest are not always available, but there is a way to circumvent it. Since fluorophore-conjugated antibodies are much more prevalent, it is possible to use magnetic nanoparticles coated with anti-fluorochrome antibodies. They are incubated with the fluorescent-labelled antibodies against the antigen of interest and may thus serve for cell separation with respect to the antigen.

The following metabolic pathway mainly results in two inactive conjugated and hydroxylated metabolites (called metabolites 5 and 6). Metabolites 5 and 6 are mainly excreted in the urine.

Alcian yellow is an azo dye with the formula (CH3[(CH3N)2CS]2C6H2SNCC6H4)2N2. Its structure consists of a largely conjugated array of benzene, benzothiazole and isothiouronium units.

Kubutz is common in verbs in the passive binyanim Pual and Huf'al and in some conjugated forms of verbs whose roots' second and third letters are the same.

Furthermore, the hydroxylated and conjugated forms are less likely to precipitate in urine. The hydrolysis takes place by the action of amidases.HSU, W.H. (2008). Handbook Of Veterinary Pharmacology.

Routledge Pub.: London. or 7 grammatical cases. Verbs are conjugated for tense, mood and aspect, but not for person, gender nor number except in archaic or poetic language.

The Macedonian conditional is conjugated in the same way for all three persons using the particle би and the verbal l-form, би читал (I/you/he would read).

His research focuses on mechanisms and regulation of protein homeostasis in eukaryotic cells, with a particular focus on how proteins are conjugated with ubiquitin and degraded by the proteasome.

Also under development are site-specific conjugation (TDCs) and novel conjugation techniques to further improve stability and therapeutic index, α emitting immunoconjugates, antibody-conjugated nanoparticles and antibody-oligonucleotide conjugates.

Humans excrete small amounts of conjugated 2-amino-3-hydroxyacetophenone, a product of tryptophan metabolism, in the urine. The plant Chrysothamnus viscidiflorus (Asteraceae) contains an m-hydroxyacetophenone named viscidone.

The default word order in sentences is subject–object–verb (SOV). In any case, the subject always precedes the object. Verbs are conjugated for person. The language is agglutinative.

Braun, R. A. J. Org. Chem. 1963, 28, 1383. Conjugated dienyl epoxides form similar products, lending support to the existence of an ylide intermediate.Eberbach, W.; Roser, J. Tetrahedron Lett.

Sentence structure determines syntactical relations and verbs are not conjugated. Instead they have particles suffixed to them. For example, the verb "to eat," ca: is itself unchanged when modified.

The intransitive verbs in Classes 2 and 3, when taken together, seem to be conjugated differently based on a form of active alignment (see the section on morphosyntactic alignment).

Phenylacetaldehyde is readily oxidized to phenylacetic acid. Therefore will eventually be hydrolyzed and oxidized to yield phenylacetic acid that will be excreted primarily in the urine in conjugated form.

Verbs are conjugated with the use of suffixes, it is an Aspect dominant language, as opposed to Tense dominant like English. Githabul suffixes mostly conjugate for aspect and mood.

Jaundice may be noticeable in the sclera of the eyes at levels of about 2 to 3 mg/dl (34 to 51 μmol/l),Merck Manual Jaundice Last full review/revision July 2009 by Steven K. Herrine and in the skin at higher levels. For conversion, 1 mg/dl = 17.1 µmol/l. Jaundice is classified, depending upon whether the bilirubin is free or conjugated to glucuronic acid, into conjugated jaundice or unconjugated jaundice..

Finally, the conjugated bile acids which remained un-ionized conjugated bile acids are passively absorbed. Venous blood from the ileum goes straight into the portal vein and then into the liver sinusoids. There, hepatocytes extract bile acids very efficiently, and little escapes the healthy liver into systemic circulation. The net effect of enterohepatic recirculation is that each bile salt molecule is reused about 20 times, often multiple times during a single digestive phase.

3-Amino-9-ethylcarbazole (AEC) is a chemical compound commonly used as a chromogenic substrate in immunohistochemistry, specifically for visualizing sections stained with HRP-conjugated secondary antibodies. After the chromogenic oxidation reaction catalyzed by HRP, a red water-insoluble precipitate is formed in situ, visualizing the location of the antigen detected by the HRP-conjugated antibody. The resulting stained section can be destained by organic solvents in which the red precipitate is soluble.

Woodward's rules, named after Robert Burns Woodward and also known as Woodward–Fieser rules (for Louis Fieser) are several sets of empirically derived rules which attempt to predict the wavelength of the absorption maximum (λmax) in an ultraviolet–visible spectrum of a given compound. Inputs used in the calculation are the type of chromophores present, the auxochromes (substituents on the chromophores, and solvent. Examples are conjugated carbonyl compounds, conjugated dienes, and polyenes.

To make fluorochrome-labeled antibodies, a fluorochrome must be conjugated ("tagged") to the antibody. Likewise, an antigen can also be conjugated to the antibody with a fluorescent probe in a technique called fluorescent antigen technique. Staining procedures can apply to both fixed antigen in the cytoplasm or to cell surface antigens on living cells, called "membrane immunofluorescence". It is also possible to label the complement of the antibody-antigen complex with a fluorescent probe.

Methylenecyclopropene is the smallest of the fulvenes (a family of unstable, cyclic molecules, conjugated transversally with an odd number of carbon atoms in the ring). The structure of methylenecyclopropene has two interacting double bonds, which represents the simplest transversally conjugated π-bonding system. It is fundamentally not an alternant hydrocarbon. The value of its dipole moment (which is around four times that of pentafulvene) can be calculated by the Hückel method (HMO).

Thus, the etanercept conjugated AuNRs were seen to increase the light sensitivity. The imaging technique provides greater opportunities for sensitive in vivo drug tracking in biothechnology. HIV Several valences of AuNPs were found to inhibit HIV fusion. 2-nm AuNP- mercaptobenzoic acid were conjugated to a derivative of a known CCR5 antagonist, which is a small molecule that antagonize CCR5 receptor, and CCR5 is commonly used by HIV to enter the cell.

Class IV verbs were formed with a suffix -nan, e.g. Gothic fullnan "to become full". The present tense was conjugated as a strong verb, e.g. Gothic fullna, fullnis, fullniþ, etc.

Coyette, J. P., & Van den Nieuwenhof, B. (2000). A conjugated infinite element method for half-space acoustic problems. The Journal of the Acoustical Society of America, 108(4), 1464-1473.

An important reaction for conjugated dienes is the Diels–Alder reaction. Many specialized dienes have been developed to exploit this reactivity for the synthesis of natural products (e.g., Danishefsky's diene).

Controlled living chain-growth conjugated polymerization will also enable the synthesis of well-defined advanced structures, including block copolymers. Their industrial applications extend to water purification, biomedical devices and sensors.

However, a role of PSMA5 was also indicated in neuroendocrine pulmonary tumors. The PSMA5 protein has further been associated with the biosynthesis of conjugated linoleic acid (CLA) in mammary tissue.

Finally, it is oxidized to 11-cis retinal before traveling back to the rod outer segment where it is again conjugated to an opsin to form new, functional visual pigment (rhodopsin).

In 2016 a synthetic peptide- conjugated PMO (PPMO) was found to inhibit the expression of New Delhi Metallo-beta-lactamase, an enzyme that many drug-resistant bacteria use to destroy carbapenems.

Acetophenone is then reduced to an alcohol and conjugated by glutathione transferases., Excretion of chlorfenvinphos is fairly rapid. In rats, an administered dose is excreted in 4 days, mostly in urine.

Dubin–Johnson syndrome is a rare, autosomal recessive, benign disorder that causes an isolated increase of conjugated bilirubin in the serum. Classically, the condition causes a black liver due to the deposition of a pigment similar to melanin. This condition is associated with a defect in the ability of hepatocytes to secrete conjugated bilirubin into the bile, and is similar to Rotor syndrome. It is usually asymptomatic, but may be diagnosed in early infancy based on laboratory tests.

On p. 90, Thiele coined the term "conjugated": "Ein solches System benachbarter Doppelbindungen mit ausgeglichenen inneren Partialvalenzen sei als conjugirt bezeichnet." (Such a system of adjacent double bonds with equalized inner partial valences shall be termed "conjugated".) Conjugation is the overlap of one p orbital with another across an intervening σ bond (in transition metals d orbitals can be involved).For the purposes of this article, we are primarily concerned with delocalized orbitals with π symmetry.

Conjugated systems form the basis of chromophores, which are light-absorbing parts of a molecule that can cause a compound to be colored. Such chromophores are often present in various organic compounds and sometimes present in polymers that are colored or glow in the dark. Chromophores often consist of a series of conjugated bonds and/or ring systems, commonly aromatic, which can include C–C, C=C, C=O, or N=N bonds. Chemical structure of beta-carotene.

Verbs are conjugated by taking the root of the verb and adding a suffix. The suffixes for recent and remote past change depending on the root class, but the future suffixes remain the same for all root classes. For example, the verb mike (to put) can be conjugated in the following ways by taking the root mika and adding suffixes. It may be translated into English by adding an adverbial phrase to express the implied actual or potential time.

At least one Finnish verb lacks the first infinitive (dictionary/lemma) form. In Finnish, "kutian helposti" ("I'm sensitive to tickling") can be said, but for the verb "kutian" (here conjugated in singular first person, present tense) there is no non-conjugated form. Hypothetically, the first infinitive could be "kudita", but this form is not actually used. Additionally, the negative verb (ei, et, en, emme...) has neither an infinitive form nor a 1st person singular imperative form.

The rule can be used to understand the stability of completely conjugated monocyclic hydrocarbons (known as annulenes) as well as their cations and anions. The best-known example is benzene (C6H6) with a conjugated system of six π electrons, which equals 4n + 2 for n = 1\. The molecule undergoes substitution reactions which preserve the six π electron system rather than addition reactions which would destroy it. The stability of this π electron system is referred to as aromaticity.

The phthalocyanine aromatic nucleus has a large conjugated system with a CBN (Conjugated bond number) of 48. However it is the charges on the isothiouronium side groups that still keeps it water-soluble. These side groups can carry bulkier alkyl or aryl substituents rather than the 8x2 methyl groups as in the image given. These groups split off from the macrocyclic ring during the washing at the end of staining or by rather mild conditions (e.g.

For chemosensor applications, silsesquioxane cages conjugated with fluorescent molecules can be directly used to detect fluoride ions under a cage-encapsulation showing a change of color under naked eyes and other anions.

Instead, estrogens like conjugated estrogens, ethinylestradiol, and diethylstilbestrol were typically used by the oral route. In 1966, oral estradiol valerate was introduced by Schering for medical use under the brand name Progynova.

Chandrasekhar's research interests are in the area of optical spectroscopy of semiconductors, superconductors, and conjugated polymers, with an emphasis on high-pressure studies. She has published over 120 papers in this area.

Verbs are generally not inflected according to person or number.Volker 1982, pp.36. Thus, the present tense form of most Unserdeutsch verbs is identical to the Standard German infinitive, which is not conjugated.

This obstruction may lead to jaundice, elevation in alkaline phosphatase, increase in conjugated bilirubin in the blood and increase in cholesterol in the blood. It can also cause acute pancreatitis and ascending cholangitis.

NanoIntegris has recently licensed a new process using selective wrapping of semiconducting nanotubes with conjugated polymers. This method is scalable thus enables the supply of this material in large quantities for commercial applications.

Most of the active compound is excreted by the kidneys (92–93%). A small proportion is glucuronidated, oxidised, N-formylated or conjugated to a hexose. The elimination half-life is about 24 hours.

When GPA is conjugated with wavelet analysis, then the method is called Gradient spectral analysis (GSA), usually applied to short time series analysis.Rosa, R.R. et al., Advances in Space Research 42, 844 (2008), .

The PUFA epoxide of arachidonic acid made by ALOX15 - eoxin A4 may also be conjugated with glutathione to form eoxin B4 which product can be further metabolized to eoxin C4, and eoxin D4.

First, one allicin molecule (1 in the diagram) fragments to form 2-propenesulfenic acid and thioacrolein. These two react in separate stages with another allicin molecule by way of a conjugated thiocationic intermediate.

By incorporation of a reactive group into a binding peptide or protein via posttranslational chemical modification or as an unnatural amino acid, a target protein can be conjugated specifically via proximity-induced reaction.

Most of them can be written before or after the noun. As for verbs, they are conjugated in five tenses: perfective, imperfective, future, imperative, conditional present and conditional past Tenses and in four forms: affirmative, exclamative, interrogative and negative forms. They can be preceded by modal verbs to indicate a particular intention, situation, belief or obligation when they are conjugated in perfective or imperfective tenses. Questions in Tunisian Arabic can be āš (wh question) or īh/lā (yes/no question).

The extended π-systems of conjugated PTs produce some of the most interesting properties of these materials—their optical properties. As an approximation, the conjugated backbone can be considered as a real-world example of the "electron-in-a-box" solution to the Schrödinger equation; however, the development of refined models to accurately predict absorption and fluorescence spectra of well- defined oligo(thiophene) systems is ongoing.Bässler, H. "Electronic Excitation". In Electronic Materials: The Oligomer Approach; Müllen, K.; Wegner, G., Eds.

Additionally, it has been shown that the interaction between APP and kinesin is specific to the peptide sequence of APP. In a recent experiment involving transport of peptide- conjugated colored beads, controls were conjugated to a single amino acid, glycine, such that they display the same terminal carboxylic acid group as APP without the intervening 15-amino-acid sequence mentioned above. The control beads were not motile, which demonstrated that the terminal COOH moiety of peptides is not sufficient to mediate transport.

Czech verbs agree with their subjects in person (first, second or third), number (singular or plural), and in constructions involving participles also in gender. They are conjugated for tense (past, present or future) and mood (indicative, imperative or conditional). For example, the conjugated verb mluvíme (we speak) is in the present tense and first-person plural; it is distinguished from other conjugations of the infinitive mluvit by its ending, -íme. The infinitive form of Czech verbs ends in -t (archaically, -ti).

In addition to the normal immunizations advised for the countries to be visited, Group A meningococcus should be included if visiting countries of particular risk (e.g. sub-saharan Africa). The non-conjugated Meningitis A and C vaccines usually used for this purpose give only 3 years coverage and provide less-effective long-term cover for Meningitis C than the conjugated form already mentioned. Those lacking a functional spleen are at higher risk of contracting malaria, and succumbing to its effects.

The transferrin was conjugated to the nanoparticle to target tumor cells that possess transferrin-receptor mediated endocytosis mechanisms on their membrane. This means of targeting was found to increase uptake, as opposed to non-conjugated nanoparticles. Active targeting can also be achieved by utilizing magnetoliposomes, which usually serves as a contrast agent in magnetic resonance imaging. Thus, by grafting these liposomes with a desired drug to deliver to a region of the body, magnetic positioning could aid with this process.

If digoxigenin was used as a probe label, an anti-digoxigenin fluorescein primary antibody followed by a HRP-conjugated anti-fluorescein secondary antibody are then applied. If biotin was used as a probe label, non-specific binding sites must first be blocked using bovine serum albumin (BSA). Then, HRP-conjugated streptavidin is used for detection. HRP then converts diaminobenzidine (DAB) into an insoluble brown product, which can be detected in a bright-field microscope under 40- to 60-fold magnification.

View of Henschel & Son conjugated valve gear mechanism used on Victorian Railways H class locomotive, driven from the outside Walschaerts valve gear These enable a 3-cylinder or 4-cylinder locomotive to be built with only two sets of valve gear. The best known is Gresley conjugated valve gear, used on 3-cylinder locomotives. Walschaerts gear is usually used for the two outside cylinders. Two levers connected to the outside cylinder valve rods drive the valve for the inside cylinder.

Estriol sulfate, or estriol 3-sulfate, is a conjugated metabolite of estriol that is present in high quantities during pregnancy. It is formed from estriol in the liver and is eventually excreted in the urine by the kidneys. It has much higher water solubility than does estriol. Estriol sulfate is the second most prevalent conjugated metabolite of estriol during pregnancy; 35 to 46% is estriol glucuronide and 15 to 22% is estriol 3-sulfate, while the double conjugate estriol sulfate glucuronide also occurs.

By the oral route, a dose of 25 mg methallenestril is approximately equivalent to 1 mg diethylstilbestrol, 4 mg dienestrol, 20 mg hexestrol, 25 mg estrone, 2.5 mg conjugated estrogens, and 0.05 mg ethinylestradiol.

Conjugated Schiff bases absorb strongly in the UV-visible region of the electromagnetic spectrum. This absorption is the basis of the anisidine value, which is a measure of oxidative spoilage for fats and oils.

The overall elimination half-life is 20–40 hours. It is conjugated in the kidney for excretion in the urine, where 75% of the drug is excreted, and about 15% is eliminated in feces.

Derivatives conjugated with fluorophores are sold widely. Because of its ability to selectively bind filamentous actin (F-actin) and not actin monomers (G-actin), fluorescently labeled phalloidin is more effective than antibodies against actin.

There are two broad ways of classifying Sanskrit verbal roots. They are: Parasmaipadi (परस्मैपदी) and Atmanepadi (आत्मनेपदी). But some roots are Ubhayapadi (उभयपदी) i.e. they are conjugated as Parasmaipadi as well as Atmanepadi roots.

Polymerization of conjugated dienes such as buta-1,3-diene or isoprene (2-methylbuta-1,3-diene) results in largely 1,4-addition with possibly some 1,2-addition of the diene monomer to a growing polymer chain.

The word data has generated considerable controversy on whether it is an uncountable noun used with verbs conjugated in the singular, or should be treated as the plural of the now-rarely-used datum.

For "conventional" cyclic compounds, aromaticity is conferred by the presence of 4n + 2 delocalized pi electrons, where n is an integer. Particular instability (antiaromaticity) is conferred by the presence of 4n conjugated pi electrons.

In addition, the language employs counter words when quantifying nouns and uses a vigesimal number system. Verbs are not conjugated according to tense, but rather are semantically altered by a series of aspect particles.

However, as the size of the conjugated system increases, the increased conjugation reduces the impact of the heavy atom effect and instead makes the polymer more efficient due to the increased conjugation reducing the bandgap.

Steroid hormones, lacking the side chain of cholesterol and bile acids, are typically hydroxylated at various ring positions or oxidized at the 17 position, conjugated with sulfate or glucuronic acid and excreted in the urine.

Reduction of titanocene dichloride in the presence of conjugated dienes such as 1,3-butadiene gives η3-allyltitanium complexes. Related reactions occur with diynes. Furthermore, titanocene can catalyze C-C bond metathesis to form asymmetric diynes.

Indirect serum bilirubin level = >5mg/dl. Total(Conjugated & unconjugated) = > 12mg/dl At term. It total bilirubin > 20mg/dl causes bilirubin encephalopathy also called Kernicterus. In most of cases there is no specific underlying disorder (physiologic).

In these areas, the verb with tu is conjugated in the third- person form (as with você) – except among educated speakers in some urban centers such as Porto Alegre and, especially, Belém. See Brazilian Portuguese.

Curiously enough, the imperfect conjugation of the auxiliary verbs seems to confuse and interchange the inflections. Etymologically the two auxiliary verbs should be conjugated as follows: véser: I sing.: sére II sing.: séret III sing.

In physics, a bipolaron is a type of quasiparticle consisting of two polarons. In organic chemistry, it is a molecule or a part of a macromolecular chain containing two positive charges in a conjugated system.

Reaction with diazomethane at the conjugated double bond at 16 gives first the pyrazole (6). This heterocycle affords the 16 methyl enone on pyrolysis (7). Selective epoxidation of the conjugated double bond to the 16,17α-epoxide over that at 5,6 is achieved by oxidation with basic hydrogen peroxide (8). Opening of this tetrasubstituted oxirane ring in acid proceeds with loss of a proton from the β position (16 methyl) (9) to afford the desired 16-methylene-17α-hydroxy-20-ketone functionality in the D ring (10).

Pholcodine is slowly biotransformed in the body via oxidation and conjugation to a series of metabolites that are eliminated primarily in the urine. With an average half-life of approximately 2.3 days, steady-state in someone taking the drug chronically would not be reached for nearly 2 weeks. Nearly one-half of a single dose is eventually excreted as free or conjugated parent drug. The most important urinary metabolite is conjugated morphine, which may be detectable for days or weeks after the last dose.

Conjugated estrogens/methyltestosterone (CEEs/MT), sold under the brand name Premarin with Methyltestosterone, is a combination of conjugated estrogens (CEEs), an estrogen, and methyltestosterone (MT), an androgen and anabolic steroid (AAR), which is used in menopausal hormone therapy for women. It contains 0.625 to 1.25 mg CEEs and 5 to 10 mg MT. The medication was marketed by Wyeth-Ayerst. CEEs/MT was previously marketed in the United States and Canada. It remains available only in Paraguay, under the brand names Delitan and Delitan Forte.

Unlike other trans fatty acids, it may have beneficial effects on human health. CLA is conjugated, and in the United States, trans linkages in a conjugated system are not counted as trans fats for the purposes of nutritional regulations and labeling. CLA and some trans isomers of oleic acid are produced by microorganisms in the rumens of ruminants. Non-ruminants, including humans, produce certain isomers of CLA from trans isomers of oleic acid, such as vaccenic acid, which is converted to CLA by delta-9-desaturase.

These E,Z,E PUFA are 20- to 100-fold stronger in inhibiting human platelet aggregation than two mono-hydroxyl-containing eicosanoids, 5-HETE and 12-HETE, which contain an E,Z conjugated double bond configuration.

Otherwise f can be conjugated by a Möbius transformation so that the fixed point is zero. An elementary proof of the theorem is given below, taken from and . Two other short proofs can be found in .

The Imperfect tense, which refers to any repeated, continuous, or habitual past action, is conjugated as follows: First class (infinitive in -à: cantà (to sing) ) I sing.: cantàe II sing.: cantàet III sing.: cantàa I plur.

A dienone is a class of organic compounds that are formally "derived from diene compounds by conversion of a –CH2– groups into –C(=O)– group .", resulting in "a conjugated structure". The class includes some heterocyclic compounds.

These enzymes use co-transcription to conjugate ubiquitin to histone H2B. Histone H2B’s level of ubiquitination varies throughout the cell cycle. All ubiquitin moieties are removed from histone H2B during metaphase and re-conjugated during anaphase.

Immunoassays employ a variety of different labels to allow for detection of antibodies and antigens. Labels are typically chemically linked or conjugated to the desired antibody or antigen. A sandwich ELISA run on a microtitre plate.

Cholestasis means "the slowing or stopping of bile flow" which can be caused by any number of diseases of the liver (which produces the bile), the gallbladder (which stores the bile), or biliary tract (also known as the biliary tree, the conduit that allows the bile to leave the liver and gallbladder and enter the small intestine). When this occurs, conjugated bilirubin and the waste products that usually would be cleared in bile reflux back into the bloodstream. This causes a primarily conjugated hyperbilirubinemia and jaundice; the liver conjugates the bile to make it water-soluble and because the bile has already been processed by the liver, when it gets backed up because of a blockage and is refluxed into the blood, the blood will have high levels of conjugated bilirubin. This is in contrast to primarily unconjugated hyperbilirubinemia which is the water-insoluble form that is bound to serum albumin; the liver has not had a chance to conjugate the bilirubin yet and can be caused either because too much unconjugated bilirubin is made (such as in massive hemolysis or ineffective erythropoiesis) or because too little is conjugated (Gilbert's disease or Crigler–Najjar syndrome).

Oxygen has two lone pairs, one of which occupies a p orbital perpendicular to the ring on that position, thereby maintaining the conjugation of that five-membered ring by overlap with the perpendicular p orbital on each of the adjacent carbon atoms. The other lone pair remains in plane and does not participate in conjugation. In general, any sp2 or sp-hybridized carbon or heteroatom, including ones bearing an empty orbital or lone pair orbital, can participate in conjugated systems, though lone pairs do not always participate in a conjugated system. For example, in pyridine, the nitrogen atom already participates in the conjugated system through a formal double bond with an adjacent carbon, so the lone pair remains in the plane of the ring in an sp2 hybrid orbital and does not participate in the conjugation.

Individuals are classified as having a functional gallbladder disorder if the above criteria are met, if the gallbladder is present, and if the testing of liver enzymes, conjugated bilirubin, and pancreatic enzymes (amylase and lipase) are normal.

Analogs of the previously mentioned heterocycles for this third family of compounds are acridine, dibenzothiophene, carbazole, and dibenzofuran, respectively. The unsaturated rings can be classified according to the participation of the heteroatom in the conjugated pi system.

Modern Hebrew has an analytic conditional~past-habitual mood expressed with the auxiliary היה haya, usually meaning "to be". It is conjugated like a past tense verb but placed before present tense conjugations of the affected verb.

BINAP is prepared from BINOL via its bistriflate derivatives. Both the (R)- and (S)-enantiomers, as well as the racemate, are commercially available. One of the wide applications include chemoselective hydrogenation, where BINAP is conjugated to rhodium.

The screw pinch might be produced in laser plasma by colliding optical vortices of ultrashort duration. A.Yu.Okulov. "Laser singular Theta-pinch", Phys.Lett.A, v.374, 4523-4527, (2010) For this purpose optical vortices ought to be phase-conjugated.

Menveo and Menactra contain the same antigens as Menomune, but the antigens are conjugated to a diphtheria toxoid polysaccharide–protein complex, resulting in anticipated enhanced duration of protection, increased immunity with booster vaccinations, and effective herd immunity.

It is caused by abnormalities in the gene coding for uridine diphosphoglucuronate glucuronosyltransferase (UGT1A1). UGT1A1 normally catalyzes the conjugation of bilirubin and glucuronic acid within hepatocytes. Conjugated bilirubin is more water soluble and is excreted in bile.

In linguistics, a defective verb is a verb with an incomplete conjugation, or one that cannot be used in some other way as normal verbs can. Defective verbs cannot be conjugated in certain tenses, aspects, or moods.

SLCO4C1 belongs to the organic anion transporter (OATP) family. OATPs are involved in the membrane transport of bile acids, conjugated steroids, thyroid hormone, eicosanoids, peptides, and numerous drugs in many tissues (Mikkaichi et al., 2004 [PubMed 14993604]).

Solutions of Cr(II) are used as specialized reducing agents of value in organic synthesis.A. Zurqiyah and C. E. Castro "Reduction of Conjugated Alkenes With Chromium(II) Sulfate: Diethyl Succinate" Organic Syntheses, Vol. 49, p.98 (1969).

Aside from specific chronic medical conditions that may lead to hyperbilirubinemia, neonates in general are at increased risk since they lack the intestinal bacteria that facilitate the breakdown and excretion of conjugated bilirubin in the feces (this is largely why the feces of a neonate are paler than those of an adult). Instead the conjugated bilirubin is converted back into the unconjugated form by the enzyme β-glucuronidase (in the gut, this enzyme is located in the brush border of the lining intestinal cells) and a large proportion is reabsorbed through the enterohepatic circulation.

Dihydroxy-E,Z,E-PUFA are metabolites of polyunsaturated fatty acids (PUFA) that possess two hydroxyl residues and three in series conjugated double bonds having the E,Z,E cis-trans configuration. These recently classified metabolites are distinguished from the many other dihydroxy-PUFA with three conjugated double bonds that do not have this critical E,Z,E configuration: they inhibit the function of platelets and therefore may be involved in controlling and prove useful for inhibiting human diseases which involve the pathological activation of these blood-borne elements.

Conjugated estrogens (CEs), or conjugated equine estrogens (CEEs), sold under the brand name Premarin among others, is an estrogen medication which is used in menopausal hormone therapy and for various other indications. It is a mixture of the sodium salts of estrogen conjugates found in horses, such as estrone sulfate and equilin sulfate. CEEs are available in the form of both natural preparations manufactured from the urine of pregnant mares and fully synthetic replications of the natural preparations. They are formulated both alone and in combination with progestins such as medroxyprogesterone acetate.

Conjugated estriol, an extract of the urine of pregnant women and sold under the brand names Progynon and Emmenin in the 1930s, was the predecessor of Premarin. Both of these products contained conjugated estrogens similarly to Premarin, but the estrogens were human estrogens as opposed to equine estrogens and the composition differed. The major active ingredient in Progynon and Emmenin was estriol glucuronide. Estrone sulfate was first isolated from the urine of pregnant mares in the late 1930s by researchers in the Department of Biochemistry at University of Toronto.

April 2–4, 1984 Osteoporosis and 1986 the FDA announced in the Federal Register that Premarin was effective for preventing osteoporosis.Food and Drug Administration. May 5, 1997 Conjugated Estrogens - Letter from Dr. Janet Woodcock: Approvability of a Synthetic Generic Version of Premarin This announcement led to a rapid growth in sales, and interest from generic manufacturers to introduce generic versions. Conjugated estrogens was introduced for medical use under the brand name Premarin in Canada in 1941, in the United States in 1942, and in the United Kingdom in 1956.

In linguistics, conjugation () is the creation of derived forms of a verb from its principal parts by inflection (alteration of form according to rules of grammar). For instance, the verb "break" can be conjugated to form the words break, breaks, broke, broken and breaking. While English has a relatively simple conjugation other languages such as French and Arabic are more complex with each verb having dozens of conjugated forms. Some languages such as Georgian and Basque have a highly complex conjugation systems with hundreds of possible conjugations for every verb.

Paracetamol crystals (crystallized from an aqueous solution) under a microscope. Paracetamol molecule polar surface area Paracetamol electrostatic potential map Paracetamol consists of a benzene ring core, substituted by one hydroxyl group and the nitrogen atom of an amide group in the para (1,4) pattern. The amide group is acetamide (ethanamide). It is an extensively conjugated system, as one lone pair on the hydroxyl oxygen, the benzene pi cloud, the nitrogen lone pair, the p orbital on the carbonyl carbon, and one lone pair on the carbonyl oxygen are all conjugated.

Vinylogous reactions are believed to occur when orbitals of the double bonds of the vinyl group and of an attached electron-withdrawing group (EWG; the π orbitals) are aligned and so can overlap and mix (i.e., are conjugated). Electron delocalization enables the EWG to receive electron density through participation of the conjugated system. Vinylogous reactions also include conjugate additions, where a nucleophile reacts at the vinyl terminus, as well as a vinylogous variation of the aldol reaction, where an electrophile is attacked by a nucleophilic vinylogous enolate (see first and following image).

The usual third-person masculine singular form is in Literary Welsh. The form is used as an optional affirmative marker before a conjugated verb at the start of a clause, but may also be found elsewhere in modern writing, influenced by spoken Welsh. The traditional third-person plural form is , which may optionally be expanded to where the previous word does not end in itself. Once more, modern authors may prefer to use the spoken form , although this cannot be done after literary forms of verbs and conjugated prepositions.

It is usually restricted to conditional clauses. It is formed from a conjugated form of auxiliary verb biti ("to be") in the imperfective aspect plus past participle, which can be in any aspect and is conjugated for gender and number. Since Serbo-Croatian has a developed aspect system this tense is considered redundant. Kad budem pojeo... ("When I will have eaten...") Nakon što budeš gotov... ("After you will have been done...") An exception to the rule is found in the Kajkavian dialect, in which future perfect is also used instead of the nonexistent future tense.

As long as the fluorophore and the quencher are in proximity, quenching inhibits any fluorescence signals. TaqMan probes are designed such that they anneal within a DNA region amplified by a specific set of primers. (Unlike the diagram, the probe binds to single stranded DNA.) TaqMan probes can be conjugated to a minor groove binder (MGB) moiety, dihydrocyclopyrroloindole tripeptide (DPI3), in order to increase its binding affinity to the target sequence; MGB-conjugated probes have a higher melting temperature (Tm) due to increased stabilisation of van der Waals forces.

A prosthetic group is the non-amino acid component that is part of the structure of the heteroproteins or conjugated proteins, being covalently linked to the apoprotein. Not to be confused with the cofactor that binds to the enzyme apoenzyme (either a holoprotein or heteroprotein) by non-covalent binding.s a non-protein (non-amino acid) This is a component of a conjugated protein that is required for the protein's biological activity. The prosthetic group may be organic (such as a vitamin, sugar, RNA, phosphate or lipid) or inorganic (such as a metal ion).

Horseradish peroxidase is a 44,173.9-dalton glycoprotein with 6 lysine residues which can be conjugated to a labeled molecule. It produces a coloured, fluorimetric, or luminescent derivative of the labeled molecule when incubated with a proper substrate, allowing it to be detected and quantified. HRP is often used in conjugates (molecules that have been joined genetically or chemically) to determine the presence of a molecular target. For example, an antibody conjugated to HRP may be used to detect a small amount of a specific protein in a western blot.

A requirement for conjugation is orbital overlap; thus, the conjugated system must be planar (or nearly so). As a consequence, lone pairs which do participate in conjugated systems will occupy orbitals of pure p character instead of spn hybrid orbitals typical for nonconjugated lone pairs. The π system of furan and lone pairs. Note that one of the oxygen lone pairs participates in conjugation in a p orbital, while the other lone pair is in an sp2 hybridized orbital in the plane of the molecule and not part of the π system.

A modular synthetic method to conjugated pentacene di-, tri- and tetramers (6–8) has been reported which is based on homo- and cross-coupling reactions of robust dehydropentacene intermediates. Non-conjugated oligomers 9–10 based on pentacene have been synthesized, including dendrimers 9–10 with up to 9 pentacene moieties per molecule with molar absorptivity for the most intense absorption > 2,000,000 M−1•cm−1. Dendrimers 11–12 were shown to have improved performance in devices compared to analogous pentacene-based polymers 4a–b in the context of photodetectors.

The negative charge in these structures is stored as an alkoxide anion. Such a nucleophilic addition is called a nucleophilic conjugate addition or 1,4-nucleophilic addition. The most important active alkenes are the aforementioned conjugated carbonyls and acrylonitriles.

Because it is inexpensive, MCPA is used in various chemical applications. Its carboxylic acid group allows the formation of conjugated complexes with metals (see above). The acid functionality makes MCPA a versatile synthetic intermediate for more complex derivatives.

The aluminium-carbon bond of the initially formed alkenylalane adds across a second molecule of alkyne, forming a conjugated dienylalane. Protonolysis provides the metal-free diene product.Zweifel, G.; Snow, J. T.; Whitney, C. C. J. Am. Chem. Soc.

Retrieved on 2007-09-25. It is composed of two chalconoids; the conjugated bonds being the cause of the red color. It is derived from precarthamin by a decarboxylase. It should not be confused with carthamidin, another flavonoid.

4-(γ-Glutamylamino)butanoic acid is molecule that consists of L-glutamate conjugated to γ-aminobutyric acid (GABA). It is the substrate of the enzyme γ-glutamyl-γ-aminobutyrate hydrolase, which is involved in the biosynthesis of polyamines.

A 2008 review found evidence suggesting that consumption of milk is effective at promoting muscle growth. Some studies have suggested that conjugated linoleic acid, which can be found in dairy products, is an effective supplement for reducing body fat.

Inheriting abnormal N-acetyltransferase which conjugated some drugs to facilitate excretion may affect the metabolism of drugs such as isoniazid, hydralazine, and procainamide. Inheriting abnormal thiopurine S-methyltransferase may affect the metabolism of the thiopurine drugs mercaptopurine and azathioprine.

However, none of the verbs are conjugated, noun gender is ignored, and correct grammar is non- existent; it doesn't detract from the overall translation from Spanish to English. Mexican Moon peaked at number 53 on the Australian ARIA Charts.

The regular Moroccan Arabic verb conjugates with a series of prefixes and suffixes. The stem of the conjugated verb may change a bit, depending on the conjugation: The stem of the Moroccan Arabic verb for "to write" is kteb.

Aromatic azo compounds tend to be brightly colored due to the extended conjugated systems. Many are used as dyes (see azo dye). Important azo dyes include methyl red and pigment red 170. Azo printing exploits this reaction as well.

Quenya has a conjugated preposition formed from the contraction of a preposition with a personal pronoun. :ótar "(together) with you (Sir or Mam)", and ótari "(together) with you (Milords or Miladies)".Vinyar Tengwar 43, p. 29 :rámen "for us".

47 In the meantime Maunsell settled upon producing a 3-cylinder version of the N class 2-6-0, which provided the opportunity to test a variant of the Gresley conjugated valve gear developed by his assistant, Harold Holcroft.

Granadaene contains a conjugated system made up of a linear chain of 12 conjugated double bonds which is connected to the amino acid ornithine at one end and the sugar rhamnose at the other. Granadaene is dark red, odorless, insoluble in water, methanol, ethanol, diethyl ether, acetone, hexane, dimethyl sulfoxide (DMSO), acetonitrile, tetrahydrofuran, chloroform, and in most solvents, it is soluble in DMSO–0.1% trifluoroacetic acid (TFA). Granadaene, can be extracted from cultures of S.agalactiae in granada broth (granada medium without agar) with 0.1 M potassium hydroxide (KOH) and purified by size-exclusion chromatography on Sephadex LH using DMSO–0.1%TFA. Streptococcus agalactiae in granada broth Ultraviolet/visible spectrum of granadaene, in DMSO+TFA Proposed metabolic pathway for granadaene biosynthesis The ultraviolet-visible absorption spectrum of the granadaene (in DMSO/TFA) is almost identical to that of a carotene with a similar conjugated system of double bonds (e.g.

Journal Society Gynecologic Investigation 4 (1 (Suppl.)) (1997) 392. In addition to 8,9-dehydroestrone and 8,9-dehydro-17β-estradiol, 8,9-dehydro-17α-estradiol is likely also to be present in conjugated estrogens, but has not been identified at this time.

Similar to antibody, aptamers TBA and HD22 show avidity effect against thrombin after dimerization. When TBA and HD22 are conjugated with an optimal linkerHasegawa, H. et al., Improvement of Aptamer Affinity by Dimerization. Sensors 8, 1090-1098 doi:10.3390/s8021090(2008).

Alternatively, it can first undergo metabolization by MAO and then by COMT; in both cases, the resulting 3O-methyl-N-demethyladrenalone is conjugated to sulfate or glucuronide and excreted by the kidney. No reduction to epinephrine has been observed in vivo.

Bilirubin di-glucuronide is a conjugated form of bilirubin formed in bilirubin metabolism. The hydrophilic character of bilirubin diglucuronide enables it to be water-soluble. It is pumped across the hepatic canalicular membrane into the bile by the transporter MRP2.

The compound is also conjugated by glucuronidation via glucuronosyltransferases and sulfation via sulfotransferases. It is not metabolized importantly by the cytochrome P450 system. The three main metabolites of brexanolone are inactive. The elimination half-life of brexanolone is 9 hours.

The risks of these adverse events in women taking ospemifene are lower than those in women taking estrogen alone in the form of oral conjugated estrogens. Studies have not documented the relative risk compared with women taking estrogen/progestin therapy.

Post-translational modification is a process where new functional group(s) are conjugated to the amino acid side chains in a target protein through reversible or irreversible biochemical reactions. The common modifications include glycosylation, phosphorylation, ubiquitination, sulfation, methylation, acetylation, and hydroxylation.

Most verbs are conjugated differently in singular and plural, while most adjectives are not. Some adjectives can though be serially joined with nouns and some have two plural forms. A pleonastic article is also always used before people's and pet's names.

Fluorochromes conjugated to the MHC-multimers then can be used for identification of T cells by flow cytometry. Nowadays, MHC molecules can be produced recombinantly together with the antigenic peptides which are known for a fast-growing number of diseases.

The word "Ojczyzna" is translated into "Motherland" as it is conjugated in the feminine form, and as the country takes on the feminine noun. It's regularly mistranslated as "Fatherland," as many authors try to attribute it to the germanization of Poland.

For example, Latin is said to have four conjugations of verbs. This means that any regular Latin verb can be conjugated in any person, number, tense, mood, and voice by knowing which of the four conjugation groups it belongs to, and its principal parts. A verb that does not follow all of the standard conjugation patterns of the language is said to be an irregular verb. The system of all conjugated variants of a particular verb or class of verbs is called a verb paradigm; this may be presented in the form of a conjugation table.

If one specializes every indeterminate qs to a single indeterminate q over the integers (or q to q½ respectively), then one obtains the so-called generic one-parameter Hecke algebra of (W,S). Since in Coxeter groups with single laced Dynkin diagrams (for example groups of type A and D) every pair of Coxeter generators is conjugated, the above-mentioned restriction of qs being equal qt whenever s and t are conjugated in W forces the multiparameter and the one-parameter Hecke algebras to be equal. Therefore, it is also very common to only look at one-parameter Hecke algebras.

This is very common in enolization reactions and can be viewed in the figure below under "Acidic Conditions." In situations where the molecule can either be in a conjugated system or avoid allylic strain, it has been shown that the molecule's major form will be the one that avoids strain. This has been found via the cyclization in the figure below. Under treatment of perchloric acid, molecule A cyclizes into the conjugated system show in molecule B. However, the molecule will rearrange (due to allylic strain) into molecule C, causing molecule C to be the major species.

Like many carotenoids, astaxanthin is a lipid-soluble pigment. Its red-orange colour is due to the extended chain of conjugated (alternating double and single) double bonds at the centre of the compound. This chain of conjugated double bonds is also responsible for the antioxidant function of astaxanthin (as well as other carotenoids) as it results in a region of decentralized electrons that can be donated to reduce a reactive oxidizing molecule. Astaxanthin is a blood-red pigment and is produced naturally in the freshwater microalgae Haematococcus pluvialis and the yeast fungus Xanthophyllomyces dendrorhous (also known as Phaffia).

Each binyan has a certain pattern of conjugation and verbs in the same binyan are conjugated similarly. Conjugation patterns within a binyan alter somewhat depending on certain phonological qualities of the verb's root; the alterations (called גִּזְרָה , meaning "form") are defined by the presence of certain letters composing the root. For example, three-letter roots (triliterals) whose second letter is ו or י are so-called hollow or weak roots, losing their second letter in binyan , in , and in much of . The feature of being conjugated differently because the second root-letter is ו or י is an example of a gizra.

There are many different names for inflected prepositions, including conjugated preposition, pronominal preposition, prepositional pronoun, and suffixed pronoun. (But note that the term prepositional pronoun also has a different sense, for which see Prepositional pronoun.) Historically, inflected prepositions can develop from the contraction of a preposition with a personal pronoun; however, they are commonly reanalysed as inflected words by native speakers and by traditional grammar. Language change over time can obscure the similarity between the conjugated preposition and the preposition-pronoun combination. For example, in Scottish Gaelic "with" is ' and "him" is ' , but "with him" is ' .

It has been shown that ELPs can be synthetically conjugated to poly (ethylene glycol). In order to perform this conjugation, a cyclooctyne functional motif is added to the poly (ethylene glycol) and an azide group is added to the ELP. Through a cycloaddition reaction involving both of the functional groups and manipulation of the solvent pH, diblock and star polymers can be formed. Rather than forming the canonical spherical clumps above the transition temperature, this specific conjugated ELP forms a micelle with amphiphillic properties, in which the polar head groups face outward and the hydrophobic domains face inward.

As amphipathic molecules with hydrophobic and hydrophilic regions, conjugated bile salts sit at the lipid/water interface and, at the right concentration, form micelles. The added solubility of conjugated bile salts aids in their function by preventing passive re-absorption in the small intestine. As a result, the concentration of bile acids/salts in the small intestine is high enough to form micelles and solubilize lipids. "Critical micellar concentration" refers to both an intrinsic property of the bile acid itself and amount of bile acid necessary to function in the spontaneous and dynamic formation of micelles.

The effects of estrogens on liver protein synthesis, such as on the synthesis of coagulation factors, lipoproteins, and triglycerides, can cause an increased risk of thromboembolic and cardiovascular complications, which in turn can result in increased mortality. The risk of thromboembolic and cardiovascular complications is significantly increased in postmenopausal women taking oral conjugated estrogens as a component of menopausal hormone therapy. Both oral estradiol and oral esterified estrogens have been found to have a significantly lower risk of thromboembolic and cardiovascular complications than oral conjugated estrogens, and transdermal estradiol appears to have no such risks at all.

The present forms of perfective verbs have retained their future meaning. The future tense of imperfective verbs is still constructed by combining a conjugated form of będę with an infinitive or a past participle: będę chwalić or będę chwalił. (I will be praising).

IBAT is most highly expressed in the ileum, where it is found on the brush border membrane of enterocytes. It is responsible for the initial uptake of bile acids, particularly conjugated bile acids, from the intestine as part of their enterohepatic circulation.

Siderophore-conjugated monobactams show promise for the treatment of multi drug-resistant pathogens. Aztreonam is a commercially available monobactam antibiotic. Other examples of monobactams are tigemonam, nocardicin A, and tabtoxin. Adverse effects to monobactams can include skin rash and occasional abnormal liver functions.

The antigen in this case is MUC1, known to be overexpressed on a variety of cancer cells and in CVac MUC1 is conjugated to the carbohydrate mannan to facilitate uptake by the dendritic cells. CVAc can be administered subcutaneously, whereas Provenge is intravenous.

This is not the case in mice and guinea pigs whose cells only have affinity for InIB in mice and InIA in guinea pigs.Babinet, Charles, et al. "Conjugated action of two species-specific invasion proteins for fetoplacental listeriosis." Nature 455.7216 (2008): 1114+.

In many West Slavic and East Slavic languages, the early Slavic past tenses have largely merged into a single past tense. In both West and East Slavic, verbs in the past tense are conjugated for gender (masculine, feminine, neuter) and number (singular, plural).

Similarly to the [2,1 - a] IF, [2,1 - b] IFs show a mirror plain of symmetry and strong biradical character. The first reduction of the fully conjugated methyl appended [2,1 - b] IF occurs at -1.13 V and the second reduction is at -2.03 V.

These verbs existed as verbal roots, which could be modified into conjugations, nouns etc. Many verbs existed which are now out of use. e.g. ಈ - To give; ಪೋರ್ - To fight; ಉಳ್ - To be, To possess. Verbs were conjugated in the past and future.

Estrogen sulfates like estrone sulfate are about twice as potent as the corresponding free estrogens in terms of estrogenic effect when given orally to rodents. This in part led to the introduction of conjugated estrogens (Premarin), which are primarily estrone sulfate, in 1941.

Catalpic acid is a conjugated polyunsaturated fatty acid. The melting point of this fatty acid is 32 °C. Catalpic acid occurs naturally in the seeds of Catalpa ovata and Southern Catalpa (Catalpa bignonioides). Seeds of Catalpa species contain about 40% catalpic acid.

Besides ethinylestradiol used in birth control pills, estradiol was the most used estrogen in the U.S. in 2016, with 13.4 million total prescriptions filled. The next most used estrogen in the U.S. in 2016 was conjugated estrogens, with 4.2 million total prescriptions filled.

Once hybridisation occurs in situ, RNA probes with the incorporated DIG-U can be detected with anti-DIG antibodies that are conjugated to alkaline phosphatase. To reveal the hybridised transcripts, alkaline phosphatase can be reacted with a chromogen to produce a coloured precipitate.

Walter BockGerman patent 511145 (Jan. 15, 1927) and his colleague Claus HeuckGerman patent 558890 (Jan. 9, 1927) independently improved the emulsion process by introducing new emulsifiers. Bock also discovered that peroxy compounds are effective initiators in the emulsion polymerization of conjugated diolefines.

Most conventional polymers such as polythylene are electrical insulators, but the development of polymers containing π-conjugated bonds has led to a wealth of polymer-based semiconductors, such as polythiophenes. This has led to many applications in the field of organic electronics.

Calendic acid (sometimes α-calendic acid) is an unsaturated fatty acid, named for the pot marigold (Calendula officinalis), from which it is obtained. It is chemically similar to the conjugated linoleic acids; laboratory work suggests it may have similar in vitro bioactivities.

Type 1 tyrosinemia typically presents in infancy as failure to thrive and hepatomegaly. The primary effects are progressive liver and kidney dysfunction. The liver disease causes cirrhosis, conjugated hyperbilirubinemia, elevated AFP, hypoglycemia and coagulation abnormalities. This can lead to jaundice, ascites and hemorrhage.

SERMs that have been approved for medical use include anordrin (+mifepristone (Zi Yun)), bazedoxifene (+conjugated estrogens (Duavee)), broparestrol (Acnestrol), clomifene (Clomid), cyclofenil (Sexovid), lasofoxifene (Fablyn), ormeloxifene (Centron, Novex, Novex-DS, Sevista), ospemifene (Osphena; deaminohydroxytoremifene), raloxifene (Evista), tamoxifen (Nolvadex), and toremifene (Fareston; 4-chlorotamoxifen).

Unlike imipenem, it is stable to dehydropeptidase-1, so can be given without cilastatin. In 2016, a synthetic peptide-conjugated PMO (PPMO) was found to inhibit the expression of New Delhi metallo-beta-lactamase, an enzyme that many drug-resistant bacteria use to destroy carbapenems.

In molecular biology, the choloylglycine hydrolase family is a family of linear amide C-N hydrolases which cleave carbon-nitrogen bonds, other than peptide bonds, in linear amides. It includes conjugated bile acid hydrolase (CBAH) , N-acylethanolamine acid amide hydrolase (NAAA) and penicillin acylase .

NaGly has been shown to inhibit the glycine transporter GLYT2a in a non-competitive fashion with arachidonic acids and secondary messenger systems of GLYT2a, suggesting a novel recognition site for the N-arachodnoyl amino acids, especially because other conjugated amino acids had similar effects.

With rate = 1 using four antennas, data is transmitted four times per symbol, where each time the data is conjugated and/or inverted. This does not change the data rate, but does give the signal more robustness and avoids sudden increases in error rates.

Unlike French, Italian has a form to express progressive aspect: in either the present or the past imperfective, the verb stare ("to stand", "to be temporarily") conjugated for person and number is followed by a present gerund (indicated by the suffix -ando or -endo ("-ing")).

Iron(0) complexes of conjugated dienes have been extensively studied. In the butadiene series, (η-CH)Fe(CO) and (η:η-CH)(Fe(CO)) have been crystallized. Many related complexes are known for substituted butadienes and related species. The species (η-isoprene)iron tricarbonyl is chiral.

Verbs in the Korean language come in last place in a clause. Verbs are the most complex part of speech, and a properly conjugated verb may stand on its own as a complete sentence. This article uses the Yale romanization in bold to show morphology.

The main difference from other ancient Indo-European languages, such as Latin, is that verbs could be conjugated in only two tenses (vs. the six "tenses," really tense/aspect combinations, of Latin), and they have no synthetic passive voice although it still existed in Gothic.

Embarazada is a past participle, meaning that it indicates a state resulting from a previous action. In English, past participles usually end in -ed (e.g., destroyed), and embarazado therefore translates directly into English as "impregnated". It is a conjugated form of embarazar "to impregnate".

Jasmonic acid is also converted to a variety of derivatives including the ester methyl jasmonate. This conversion is catalyzed by the jasmonic acid carboxyl methyltransferase enzyme. It can also be conjugated to amino acids in some biological contexts. Decarboxylation affords the related fragrance jasmone.

Plasmonic nanostructures with conductive polymers have also been suggested as one kind of electronic paper.Xiong, Kunli; Emilsson, Gustav; Maziz, Ali. "Plasmonic Metasurfaces with Conjugated Polymers for Flexible Electronic Paper in Color"Advanced Materials: sid. n/a–n/a. doi:10.1002/adma.201603358. ISSN 1521-4095.

Jacaric acid is a conjugated polyunsaturated fatty acid with a melting point of 44 °C. It occurs naturally in the seeds of the Jacaranda mimosifolia, which contain about 36% jacaric acid.Gunstone, F.D et al. (2007). The Lipid Handbook with CD-ROM, Boca Raton: CRC Press.

Estrogen doses in transgender women were reduced following the introduction of antiandrogens. Ethinylestradiol, conjugated estrogens, and other non- bioidentical estrogens stopped being used in transgender women in favor of estradiol starting around 2000 due to their greater risks of blood clots and cardiovascular issues.

Isopropylphenidine's metabolic pathway consists of N-oxidation, N-dealkylation, mono- and bis-hydroxylation of the benzene ring, and hydroxylation of the phenyl ring only after N-dealkylation. The dihydroxy metabolites were conjugated by methylation of one hydroxy group, and hydroxy metabolites by glucuronidation or sulfation.

Ephenidine's metabolic pathway consists of N-oxidation, N-dealkylation, mono- and bis-hydroxylation of the benzene ring, and hydroxylation of the phenyl ring only after N-dealkylation. The dihydroxy metabolites were conjugated by methylation of one hydroxy group, and hydroxy metabolites by glucuronidation or sulfation.

Electrostatic interactions were also investigated by Rotello et al by conjugating AuNPs with anionic and cationic functional groups. Their results showed that toxicity was more established in AuNPs conjugated with cationic functional groups as a consequence of electrostatic interactions with the anionic cell membrane.

In this case local rigidity never holds. For cocompact lattices a small deformation remains a cocompact lattice but it may not be conjugated to the original one (see Teichmüller space for more detail). Non-cocompact lattices are virtually free and hence have non-lattice deformations.

The verbs generally conjugated (in form, according to many factors, including its tense, aspect, mood and voice. It also agree with the person, gender, and/or number of some of its arguments (subject, object, etc.). The verb generally appears at the end of the sentence.

Estrogenic substances was marketed under a variety of different brand names including Amniotin (Squibb), Equine Estrogenic Substances (Ayerst), Estrogenic Hormones (Upjohn, others), Estrogenic Substances (Reed & Carnrick, Sharp & Dohme, others), Estrolin (Lakeside), Estromone, Estronat (National Drug), Folestrin (Armour), Follacro (Schieffelin), Menformon (Roche-Organon), Neo-Amniotin (Squibb), Oestroform, Ova-Estrin, Theelestrin, and Urestrin (Upjohn), among others. It was provided in various forms and routes of administration including oil solution and aqueous suspension for intramuscular injection, oral tablets and capsules, vaginal suppositories, and topical ointments. Estrogen medications similar to but distinct from estrogenic substances included conjugated estriol (Emmenin) and conjugated estrogens (Premarin). They are also non-crystalline mixtures of estrogens.

Spanish morphologically distinguishes the indicative, imperative, subjunctive, and conditional moods. In the indicative mood, there are synthetic (one-word, conjugated for person/number) forms for the present tense, the past tense in the imperfective aspect, the past tense in the perfective aspect, and the future tense. The past can be viewed from any given time perspective by using conjugated "to have" in any of its synthetic forms plus the past participle. When this compound form is used with the present tense form of "to have", perfect tense/aspect (past action with present continuation or relevance) is conveyed (as in Portuguese but unlike in Italian or French).

Their chemical structures feature a large ring of atoms (in essence, a cyclic ester ring) containing multiple conjugated carbon-carbon double bonds (hence polyene) on one side of the ring and multiple hydroxyl groups bonded to the other side of the ring. Their structures also often have a d-mycosamine (a type of amino- glycoside) group bonded to the molecule. The series of conjugated double bonds typically absorbs strongly in the ultraviolet-visible region of the electromagnetic spectrum, often resulting in the polyene antibiotics having a yellow color. Chemical structure of Amphotericin B. Amphotericin B is an example of a yellow polyene antimycotic agent.

One common feature of OFET materials is the inclusion of an aromatic or otherwise conjugated π-electron system, facilitating the delocalization of orbital wavefunctions. Electron withdrawing groups or donating groups can be attached that facilitate hole or electron transport. OFETs employing many aromatic and conjugated materials as the active semiconducting layer have been reported, including small molecules such as rubrene, tetracene, pentacene, diindenoperylene, perylenediimides, tetracyanoquinodimethane (TCNQ), and polymers such as polythiophenes (especially poly(3-hexylthiophene) (P3HT)), polyfluorene, polydiacetylene, poly(2,5-thienylene vinylene), poly(p-phenylene vinylene) (PPV). The field is very active, with newly synthesized and tested compounds reported weekly in prominent research journals.

More recently azide functional groups have been conjugated to the N-terminal of a dragline silk protein using EDC/NHS coupling, yielding glycopolymer-conjugated films with enhanced cell adhesion and DNA-silk chimeras with controllable micro-architectures. Armed with this, the researchers in this study investigated the incorporation of 3 L-Aha residues into 4RepCT, yielding 4RepCT^{3Aha} . The azide side chains of L-Aha allow highly specific and efficient site-specific conjugation to a lot different of functional molecules via Staudinger ligation with phosphine reagents, and Copper (I)-catalysed azide-alkyne cycloaddition (CuAAC) or Strain promoted azide-alkyne cycloaddition (SPAAC) in click reactions.

See Gresley conjugated valve gear for more detail. When it proved impractical to mount the conjugation apparatus behind the cylinders on the N1 Holcroft had to revise the design to have the apparatus in front of the cylinders. He did not wish to use an extension of the valve spindles, as on Gresley conjugated valve gear. Instead, Holcroft carried-forward the action of the combination lever assembly that controlled the fore and aft movement of the valve spindle (which admitted "live" steam into the cylinder and ejected "spent" steam out through the ports) to a pivot point connected to a lever from the "inside" valve spindle.

Parmigiano expresses negation in two parts, with the particle n attached to the verb and one or more negative words (connegatives) that modify the verb or one of its arguments. Negation encircles a conjugated verb with n after the subject and the negative adverb after the conjugated verb, For example, the simple verbal negation is expressed by n before the finite verb (and any object pronouns) and the adverb miga after the finite verb. That is a feature it has in common with French, which uses ne and pas. Pas derives from the Latin passus "step", and miga "piece of bread" also derives from a small quantity.

Prior to secreting any of the bile acids (primary or secondary, see below), liver cells conjugate them with either glycine or taurine, to form a total of 8 possible conjugated bile acids. These conjugated bile acids are often referred to as bile salts. The pKa of the unconjugated bile acids are between 5 and 6.5, and the pH of the duodenum ranges between 3 and 5, so when unconjugated bile acids are in the duodenum, they are almost always protonated (HA form), which makes them relatively insoluble in water. Conjugating bile acids with amino acids lowers the pKa of the bile-acid/amino-acid conjugate to between 1 and 4.

Micelles refers to a type of supramolecular structure consisting of amphiphilic molecules self-assemblies, usually hollow centered. Researchers successfully conjugated a diblock copolymer site specifically onto GFP, the resulting amphiphilic polymer-protein conjugate is capable of reversible self-assembly into micelles. In addition to retaining the native globular shape of proteins, the polypeptide backbone of denatured proteins can also be utilized to be conjugated with hydrophilic polymer chains to generate higher ordered structure through hydrophobic interactions. For example, nanoconjugates of poly-ethylene glycol(PEG) and denatured bovine serum albumin(BSA) will spontaneously self-assemble into a micellar structure, whose protein core can adsorb high numbers of hydrophobic drugs.

Insert Therapeutics, Inc., now Calando Pharmaceuticals, Inc., is a medical research company that uses nanobiotechnology specializing in therapeutic agents that are conjugated, to facilitate and enhance drug delivery. The small company was founded in 2000, is located in Pasadena, California, and is owned by Arrowhead Research Corporation.

FUCCI is a system that takes advantage of cell cycle phase-specific expression of proteins and their degradation by the ubiquitin-proteasome pathway. Two fluorescent probes - Cdt1 and Geminin conjugated to fluorescent proteins - allow for real-time visualization of the cell cycle phase a cell is in.

Pigments are particularly susceptible to altered appearances based on physical properties. Most modern synthetic dye molecules contain two components. The first part is an aromatic benzene ring or system of benzene rings, often substituted. The second is a chromophore, a conjugated double bond system with unsaturated groups.

General structure of α,β-Unsaturated carbonyl compounds. α,β-Unsaturated carbonyl compounds refers to organic compounds with the general structure (O=CR)−Cα=Cβ-R. Examples would be enones and enals. In these compounds the carbonyl group is conjugated with an alkene (hence the adjective unsaturated).

This highly strained and reactive molecule was synthesized and characterized for the first time in 1984, and has been the subject of considerable experimental and theoretical interest. It is an example of a cross-conjugated alkene, being composed of cyclopropene with an exocyclic double bond attached.

Families of nonconjugated dienes are derived from the oligomerization and dimerization of conjugated dienes. For example, 1,5-cyclooctadiene and vinylcyclohexene are produced by dimerization of 1,3-butadiene. Diene-containing fatty acids are biosynthesized from acetyl CoA. α,ω-Dienes have the formula (CH2)n(CH=CH2)2.

In addition, the reactions proceed in high chemical yield under mild conditions. The intermediate enamines are electronically related to push–pull olefins, having an electron-withdrawing nitro group conjugated to an electron-donating group. The extended conjugation means that these compounds are usually an intense red colour.

Newfoundland English often follows the Northern Subject Rule, a legacy of settlement from South East Ireland which in turn was influenced by Anglo-Irish settlement from Northern England into Ireland. For example, the verb "to fly" is conjugated for third person plural as the birds flies.

Basis p orbitals of benzene. Benzene π molecular orbitals according to Hückel theory. Molecular orbitals are frequently described as linear combinations of atomic orbitals, whose coefficients are indicated here by the size and shading of the orbital lobes. Cyclic compounds can be partly or completely conjugated.

2013, 23, 514-522. 4\. Colbert, A.; Janke, E.; Hsieh, S.; Subramaniyan, S.; Schlenker,C. W.; Jenekhe, S. A.; Ginger, D. S. “Hole Transfer from Low Bandgap Quantum Dots to Conjugated Polymers in Organic/Inorganic Hybrid Photovoltaics,” J. Phys. Chem. Lett. 2013, 4, 280-284. 5\.

In fluids, glasses and amorphous solids there is no long range correlation and the dispersion relations are isotropic. This makes density of states calculations of absorption band shapes easier. For charge-transfer complexes and conjugated systems the band width is determined by a variety of factors.

ATG12 is conjugated to ATG5 in a ubiquitin-like reaction that requires ATG7 and ATG10. The Atg12–Atg5 conjugate then interacts non-covalently with ATG16 to form a large complex. LC3/ATG8 is cleaved at its C terminus by ATG4 protease to generate the cytosolic LC3-I.

Compound infinitives can be constructed by the usage of modal verbs or auxiliary verbs. One places a new infinitive behind the main infinitive. Then this outer infinitive will be conjugated instead of the old inner infinitive. Sometimes one must turn the old infinitive into a passive participle.

Bile acids are steroid acids found predominantly in the bile of mammals and other vertebrates. Diverse bile acids are synthesized in the liver. Bile acids are conjugated with taurine or glycine residues to give anions called bile salts. Primary bile acids are those synthesized by the liver.

McNeil's lab at the University of Michigan is known for providing mechanistic understanding to the catalyst transfer polymerization process, helping to show that the likely intermediate is a catalyst-polymer π-complex, but the lab has a diverse focus. For her work on conjugated polymers, there has been considerable focus on expanding the use of catalyst transfer polymerization to make polymers of novel or hard-to-reach architectures (such as conjugated gradient copolymers or insulating-conducting block copolymers) and for studying the properties of new conjugated polymers or new blends of known polymers in solar cells to improve their performance. Another focus has been on molecular gelation; McNeil has published molecular gels as sensors of many harmful or hard to detect compounds. This is with the underlying assumption that it is easier to determine if a gel has formed (since it will go from a flowing solution to a gel that resists flow) rather than alternatives, such as if a solution has changed color (hard to tell if the analyte is strongly colored).

To make the sentence negative, não is simply added before the conjugated form of ter: eu não terei falado. When using the future perfect with oblique pronouns, European Portuguese and formal written Brazilian Portuguese use mesoclisis of the pronoun in the affirmative form and place the pronoun before the auxiliary verb in the negative form: : Eu tê-lo-ei visto ("I will have seen him") : Eu não o terei visto ("I will not have seen him") : Eles ter-me-ão visto ( "They will have seen me") : Eles não me terão visto ("They will not have seen me") Informal Brazilian Portuguese usually places stressed pronouns such as me, te, se, nos and lhe/lhes between the conjugated form of ter and the past participle: eles terão me visto; in the negative form, both eles não terão me visto and eles não me terão visto are possible, but the latter is more formal and preferred in the written language. Unstressed pronouns like o and a are normally placed before the conjugated form of ter: eu o terei visto; eu não o terei visto.

As with other Germanic languages, IcelandicEinarsson, Stefán, Icelandic, Johns Hopkins Univ. Press, 2000. has two simple verb forms: past and non-past. Compound constructions that look to the past from a given time perspective use conjugated "to have" (or "to be" for intransitive verbs of motion) plus past participle.

Particular fatty acids are still needed at critical life stages (e.g. lactation) and in some disease states. In nonscientific writing, common usage is that the term essential fatty acid comprises all the ω-3 or -6 fatty acids. Conjugated fatty acids like calendic acid are not considered essential.

Hollow have a W or Y as the middle root consonant. Note that for some forms (e.g. form II and form III), hollow verbs are conjugated as strong verbs (e.g. form II ʕeyyen/yʕeyyen "appoint" from ʕ-Y-N, form III ʒaweb/yʒaweb "answer" from ʒ-W-B).

Lao verbs (ກະລິຍາ, ) are not conjugated for tense, mood, or pronoun. Tense is indicated by using time reference words, such as yesterday, next year, just now or by certain particles. Nouns that begin with ການ ( ) or ຄວາມ ( ), often nominalised verbs, become verbs again when those particles are dropped.

The first example of protein A being coupled to a porous bead for purification of IgG was published in 1972. Immunoprecipitation studies with protein A conjugated to beads are also commonly used to purify proteins or protein complexes indirectly through antibodies against the protein or protein complex of interest.

Carbonyl dyes are dyes which comprise at least two conjugated carbonyl groups. Both anthraquinone dyes and indigo dyes belong to the group of carbonyl dyes. The most important natural dyes - indigo, purple, alizarin and carmine - have this partial structure. The most important synthetic carbonyl dyes are based on anthraquinone.

Five specific antigens have been identified that can be used measured in the sera of the infected patients using antibodies conjugated to fluorescein dye. The diagnosis of the rare cases, such as gastrointestinal basidiobolomycosis, is challenging given the nonspecific clinical presentation as well as the need for surgical biopsy.

The observed mass shift indicates that it is likely that hydroxylation occurs in both the naphthalene and indole portions of the molecule. Human metabolites were similar although most metabolism took place on the indole ring and pentyl side chain, and the hydroxylated metabolites were extensively conjugated with glucuronide.

The human oral bioavailability is approximately 50% and maximum plasma concentration was achieved within 1–2 hours after dosing. Emedastine is mainly metabolized by the liver. There are two primary metabolites: 5-hydroxyemedastine and 6-hydroxyemedastine. They are excreted in the urine as both free and conjugated forms.

Both darolutamide and ketodarolutamide are bound mainly to albumin. Darolutamide and ketodarolutamide appear to negligibly cross the blood–brain barrier both in mice and humans. Darolutamide is primarily metabolized into ketodarolutamide via dehydrogenation by CYP3A4 in the liver. The medication is also conjugated via glucuronidation by UGT1A9 and UGT1A1.

Polyphenols are molecules owing their UV/Vis absorptivity to aromatic structures with large conjugated systems of pi electron configurations; they also have autofluorescence properties, especially lignin and the phenolic part of suberin.Force A, See to Act.FLUORESCENCE AND POLYPHENOLS retrieved 31 July 2013. They are reactive species toward oxidation.

There are important differences between the processing of small molecule organic semiconductors and semiconducting polymers. Small molecule semiconductors are quite often insoluble and typically require deposition via vacuum sublimation. While usually thin films of soluble conjugated polymers. Devices based on conductive polymers can be prepared by solution processing methods.

Elimination of selenoxides takes place through an intramolecular syn elimination pathway. The carbon–hydrogen and carbon–selenium bonds are co-planar in the transition state. (2)File:SelenMech1.png The reaction is highly trans-selective when acyclic α-phenylseleno carbonyl compounds are employed. Formation of conjugated double bonds is favored.

Short-term precision estimates of BMD measurement by 3D QCT have been published for the lumbar spine as 0.8%J. C. Prior et al., "Premenopausal ovariectomy-related bone loss: a randomized, double-blind, one-year trial of conjugated estrogen or medroxyprogesterone acetate.," Journal of Bone and Mineral Research, vol.

Hollow have a W or Y as the middle root consonant. Note that for some forms (e.g. form II and form III), hollow verbs are conjugated as strong verbs (e.g. form II ʕáyyin/yiʕáyyin "appoint" from ʕ-Y-N, form III gá:wib/yigá:wib "answer" from G-W-B).

As shown in the figure, a protein is firstly conjugated with the initiator and the polymer chain then grows from the protein core in a controlled manner via living polymerization. Likewise, to the earlier discussed methods, grafting from approach can be designed for site-specific or random attachment.

Words of Guarani language origin also make up the vocabulary, an example being the largely used word "guri", meaning "boy". The Gaúchos are also famous by their use of the pronoun "tu", instead of "você", the latter being the formal second person singular noun and the first being the informal noun equivalent. In the traditional Gaúcho dialect of the Pampas, the verb is conjugated correctly in the second person singular, just like the European Portuguese (tu cantas, tu bates, tu partes, tu pões). In the colloquial Portuguese of Porto Alegre, however, the verb is conjugated in the second person as in the third person (tu canta, tu bate, tu parte, tu põe).

In the auxiliary language Interlingua, verbs are not conjugated by person. Impersonal verbs take the pronoun il: :Il ha nivate heri. (Interlingua) In the planned auxiliary language Esperanto, where verbs also are not conjugated for person, impersonal verbs are simply stated with no subject given or implied, even though Esperanto is otherwise not a null subject language: :Neĝis hieraŭ. (Esperanto)A Complete Grammar of Esperanto In the planned logical language Lojban, impersonal verbs simply have no first argument filled and might not have any arguments filled at all: :carvi ca lo prulamdei (Lojban) where carvi is a verb meaning x1 rains/showers/[precipitates] to x2 from x3 where x1, x2, x3 are numbered core arguments.

Futurity can also be expressed with "go" plus the infinitive: Hij gaat een brief schrijven "He goes a letter to_write", "He is going to write a letter". The future perfect tense/aspect combination is formed by conjugated zullen + hebben ("to have") (or zijn ("to be")) + past participle: Zij zullen naar Breda gegaan zijn ("They will have gone to Breda"). The conditional mood construction uses the conjugated past tense of zullen: Hij zou graag thuis blijven "He would gladly home to_stay", "He would gladly stay home". The past tense/conditional mood combination is formed using the auxiliary "to have" or "to be": Hij zou graag thuis gebleven zijn "He would gladly home stayed to_be", "He would gladly have stayed home".

South Eastern and Chatham Railway official photograph of Maunsell N1 prototype No. 822, taken at Ashford works in 1922. The lever running forward across the outside cylinder is part of the Holcroft valve gear which drives the valve of the inside cylinder The Holcroft valve gear was a type of conjugated valve gear designed by Harold Holcroft and used on three-cylinder steam locomotives of the South Eastern and Chatham Railway (SECR). It bore many similarities to the Gresley conjugated valve gear used on the original LNER A1 design. It varied from the Gresley method of operation by using the combination lever assembly instead of the valve spindles to drive the middle cylinder of a three-cylinder design.

When working for the GWR at Swindon, Holcroft schemed out and patented (in 1909) a conjugated valve gear for three-cylinder steam locomotives, which allowed for the elimination of the valve gear for the inside cylinder by deriving the motion for the inside valve from that of the outside valves. This would be done by an assembly of levers behind the cylinder block. Somewhat later, Nigel Gresley of the GNR had designed and patented his own application of conjugated valve gear (Late 1916) which required further development to enable it to be applied to three cylinders of differing inclination. Gresley was involved with ARLE and he and Holcroft met at the formers office at Kings Cross in January 1919.

The equivalent dosage in the case of oral estradiol has not been reported. However, on the basis of the results of one study, it appears to be greater than 8 mg/day. In addition, oral estradiol is known to have similar or slightly lower antigonadotropic potency than oral conjugated estrogens; the potencies of oral conjugated estrogens in terms of suppression of LH and FSH levels are 1.0 and 1.1–1.3 relative to oral estradiol, respectively. In addition to their antigonadotropic effects, high concentrations of estrogens appear to have toxic effects in the testes, and, with long-term (>3 years) therapy, can possibly permanently reduce the capacity of the testes to produce testosterone.

The incorporation of electron-accepting nitrogen atoms in the conjugated nanotube carbon plane appears to impart a relatively high positive charge density on adjacent carbon atoms. This effect, coupled with aligning the nitrogen-doped CNTs, provides a four-electron pathway for the oxygen reduction reactions on VANTAs with a superb performance.

Thus, the presence of pale stool (stercobilin absent from feces) and dark urine (conjugated bilirubin present in urine) suggest an obstructive cause of jaundice. Because these associated signs are also positive in many hepatic jaundice conditions, they cannot be a reliable clinical feature to distinguish obstruction versus hepatocellular jaundice causes.

The past tense was conjugated with suffix -nō-, e.g. Gothic fullnōda, fullnōdēs, etc. This class vanished in other Germanic languages; however, a significant number of cognate verbs appear as Class II verbs in Old Norse and as Class III verbs in Old High German. This class has fientive semantics, i.e.

Desalting is used to remove salts from protein solutions, phenol or unincorporated nucleotides from nucleic acids or excess crosslinking or labeling reagents from conjugated proteins. Buffer exchange is used to transfer a protein solution into a buffer system appropriate for downstream applications such as ion exchange, electrophoresis or affinity chromatography.

After blocking overnight, embryos were treated with a primary antibody solution at 1:2000 (in NGS/PBS). Secondary antibody tagged with fluorescein isothiocyanate (FITC)-conjugated anti-rabbit IgG (polyclonal) was incubated at 1:20, overnight at 4 °C. Embryos were then mounted on a slide and viewed with fluorescent microscopy.

About 40% is excreted as conjugated metabolites into the urine, and a similar amount is excreted into the feces. Traces of unmetabolised loratadine can be found in the urine. In structure, it is closely related to tricyclic antidepressants, such as imipramine, and is distantly related to the atypical antipsychotic quetiapine.

Organic chemistry, Oxford University Press pp. 1450–1466 Usually polymers are electrically insulators, at best, semiconductors. For use as an electrolyte in e-caps, electrical conductive polymers are employed. The conductivity of a polymer is obtained by conjugated double bonds which permit free movement of charge carriers in the doped state.

The genus name Mimetes (Μιμητές) is Ancient Greek and means "imitators", because its leaves are similar to those of several other genera. The word is masculine in Greek and Salisbury conjugated the species names accordingly. Robert Brown, and Phillips and Hutchinson made feminine epithets. Rourke in 1984 agreed with Salisbury.

Rumenic acid, also known as bovinic acid, is a conjugated linoleic acid (CLA) found in the fat of ruminants and in dairy products. It is an omega-7 trans fat. Its lipid shorthand name is cis-9, trans-11 18:2 acid. The name was proposed by Kramer et al.

During studies and tests, the conjugated liquid DTPw-HepB-Hib vaccine was found to have positive safety when given as a booster to young children who have been given a vaccination course with another pentavalent booster that requires a change in constitution and was also found to be adequately immunogenic.

Fulvene(Pentafulvene) usually refers to the hydrocarbon (CH=CH)2C=CH2. It is a prototype of a cross-conjugated hydrocarbon The parent, fulvene itself, is rarely encountered, but substituted derivatives are numerous. They are mainly of interest as ligands and precursors to ligands in organometallic chemistry. They are often yellow.

Spanish verbs are conjugated in three persons, each having a singular and a plural form. In some varieties of Spanish, such as that of the Río de la Plata Region, a special form of the second person is used. Because Spanish is a "pro-drop language", subject pronouns are often omitted.

In addition to the element to which fluorescence probes are attached, there are two general classes of immunofluorescence techniques: primary and secondary. The following descriptions will focus primarily on these classes in terms of conjugated antibodies. There are two classes of immunofluorescence techniques, primary (or direct) and secondary (or indirect).

Yttrium (90Y) tacatuzumab tetraxetan (trade name AFP-Cide) is a humanized monoclonal antibody intended for the treatment of cancer.Statement On A Nonproprietary Name Adopted By The USAN Counil The antibody itself, tacatuzumab, is conjugated with tetraxetan, a chelator for yttrium-90,WHO Drug Information a radioisotope which destroys the tumour cells.

Thomas J. Kealy (1962): "The Chemistry of Diazaquinones: 3,6-Pyridazinedione and 1,4-Phthalazinedione". Journal of the American Chemical Society, volume 84, issue 6, pages 966–973. Roy Glenn. Miller, Thomas J. Kealy, and Arthur L. Barney (1967): "Codimerization of α-olefins and conjugated dienes by a nickel-based coordination catalyst".

Past participles are formed directly from verbal roots for most verbs (except for verbs of the tenth gaṇa, which form them from the present stem). They have a perfective sense, in that they refer to actions that are completed. They can freely substitute for finite verbs conjugated in the past sense.

Resveratrol (3,5,4'-trihydroxystilbene) is a stilbenoid, a derivative of stilbene. It exists as two geometric isomers: cis- (Z) and trans- (E), with the trans-isomer shown in the top image. Resveratrol exists conjugated to glucose. The trans- form can undergo photoisomerization to the cis- form when exposed to ultraviolet irradiation.

Other detoxification pathways of gutoxon are via glutathione-mediated dealkylation, which goes via cleavage of the P-O-CH3 bond to form demethylated AzM and GS- CH3 (reaction 7 in figure 2), and via glutathione-catalyzed dearylation to yield DMTP and glutathione-conjugated mercaptomethyl benzazimide (reaction 8 in figure 2).

With alkyds typical methods include maleinization of unsaturated fatty acids with maleic anhydride. This involves making a Diels-Alder adduct near the double bond sites. The acid groups introduced can then be further reacted with polyols. A Diels-Alder reaction only occurs where there is a conjugated double bond system.

Sulfonamides are usually metabolized by several oxidative pathways, acetylation, and conjugation with sulfate or glucuronic acid. However, there are some differences in biotransformation between certain species. Acetylation, which reduces the solubility of sulfonamides, is for example poor developed in dogs. The acetylated, hydroxylated, and conjugated forms have little antibacterial activity.

For those with liver involvement, transaminases and direct bilirubin are elevated in liver function tests. The Icterohaemorrhagiae serogroup is associated with jaundice and elevated bilirubin levels. Hemolytic anemia contributes to jaundice. A feature of leptospirosis is acute haemolytic anaemia and conjugated hyperbilirubinemia, especially in patients with glucose-6-phosphate dehydrogenase deficiency.

Thus the conjugated p-orbitals form a one-dimensional electronic band, and the electrons within this band become mobile when it is emptied partly. Despite intensive research, the relationship between morphology, chain structure, and conductivity is poorly understood yet.Skotheim, T., Elsenbaumer, R., Reynolds, J., Eds.; Handbook of Conducting Polymers, 2nd ed.

Estriol was first discovered in 1930, and was introduced for medical use shortly thereafter. Estriol esters such as estriol succinate are also used. Although it is less commonly employed than other estrogens like estradiol and conjugated estrogens, estriol is widely available for medical use in Europe and elsewhere throughout the world.

Bengali nouns are not assigned gender, which leads to minimal changing of adjectives (inflection). However, nouns and pronouns are moderately declined (altered depending on their function in a sentence) into four cases while verbs are heavily conjugated, and the verbs do not change form depending on the gender of the nouns.

By 2005, the group had revised its synthesis method for a more streamlined, higher yield-producing route. It involved the photochemical conversion of precursor 7-dehydrositosteryl acetate to contain a conjugated triene system, a hallmark of this analog, followed by hydroxylation, photoisomerization and deprotection steps. Their overall yield was 48%.

In healthy humans, CLA and the related conjugated linolenic acid (CLNA) isomers are bioconverted from linoleic acid and alpha- linolenic acid, respectively, mainly by Bifidobacterium bacteria strains inhabiting the gastrointestinal tract. However, this bioconversion may not occur at any significant level in those with a digestive disease, gluten sensitivity, or dysbiosis.

Due to its stability, processability, and electrical and optical properties, PPV has been considered for a wide variety of applications. In 1989 the first polymer-based light emitting diode (LED) was discovered using PPV as the emissive layer.Burroughes, J. H. et al. Light-Emitting Diodes Based on Conjugated Polymers. Nature. 1990. 347, 539.

Using the absorbance and emission profile of discrete conjugated oligo(3-hexylthiophene)s prepared through polymerization and separation, Lawrence et al. determined the effective conjugation length of poly(3-hexylthiophene) to be 14 units. The effective conjugation length of polythiophene derivatives depend on the chemical structure of side chains, and thiophene backbones.

Urobilin is excreted by the kidneys to give urine its yellow color and stercobilin is excreted in the feces giving stool its characteristic brown color. A trace (~1%) of the urobilinogen is reabsorbed into the enterohepatic circulation to be re-excreted in the bile. Conjugated bilirubin's half-life is shorter than delta bilirubin.

Ubiquitin-fold modifier 1, also known as UFM1, is a protein which in humans is encoded by the UFM1 gene. UFM1 is a ubiquitin-like protein that is conjugated to target proteins by E1-like activating enzyme UBA5 and E2-like conjugating enzyme UFC1. This process is often referred to as UFMylation.

In molecules with alternating double bonds and single bonds, p-orbital overlap can exist over multiple atoms in a chain, giving rise to a conjugated system. Conjugation can be found in systems such as dienes and enones. In cyclic molecules, conjugation can lead to aromaticity. In cumulenes, two double bonds are adjacent.

Radioimmunotherapy (RIT) involves the use of radioactively-conjugated murine antibodies against cellular antigens. Most research involves their application to lymphomas, as these are highly radio-sensitive malignancies. To limit radiation exposure, murine antibodies were chosen, as their high immunogenicity promotes rapid tumor clearance. Tositumomab is an example used for non-Hodgkin's lymphoma.

There is also a compound future imperfective form consisting of the future of "to be" plus the infinitive of the imperfective verb. The conditional mood is expressed by a particle (=English "would") after the past tense form. There are conjugated modal verbs, followed by the infinitive, for obligation, necessity, and possibility/permission.

Simple aromatic rings, also known as simple arenes or simple aromatics, are aromatic organic compounds that consist only of a conjugated planar ring system. Many simple aromatic rings have trivial names. They are usually found as substructures of more complex molecules ("substituted aromatics"). Typical simple aromatic compounds are benzene, indole, and pyridine.

Recent usage of kava has been documented in forensic investigations by quantitation of kavain in blood specimens. The principal urinary metabolite, conjugated 4'-OH-kavain, is generally detectable for up to 48 hours.R. Baselt, Disposition of Toxic Drugs and Chemicals in Man, 8th edition, Biomedical Publications, Foster City, CA, 2008, pp. 803–804.

In one study, a toxin (pokeweed antiviral protein) was conjugated to GnRH to target the GnRH receptors on the pituitary gonadotrophs. Treatment of dogs showed a decrease in testosterone, which however was not permanent. A number of approaches of this kind have been attempted with no evidence of effectiveness in any species.

His published research includes the addition reaction of phenols with ethylene,, the chemistry of allene (propadiene, ), the synthesis of diazaquinones, the co-dimerization of monoalkenes and conjugated dienes. He also filed a patent on synthesis of biciclooctenones in 1957, one on diazaquinones in 1960, and one on extrudable alkene copolymers in 1968.

Biosynthesis of cis-3-hexenal from linolenic acid via the hydroperoxide by the action of a lipoxygenase followed by a hydroperoxide lyase. cis-3-Hexenal is an aldehyde. It is relatively unstable and isomerizes into the conjugated trans-2-hexenal. The related alcohol cis-3-hexen-1-ol is much more stable.

Alkynyl ethers and siloxyacetylenes have proven to be the ideal pair for aromatic annulations. The reactions can be run with both activated heterosubstituted alkynes and un-activated acetlyenes. Alkynyl thioethers and ynamines have been used as reactants in the annulation reaction. Conjugated enynes have also been used for benzannulation reactions catalyzed by cobalt.

Simple addition occurs if not conjugated. Other techniques include synthesizing the resin with hydroxyl functional oligomers e.g. containing ethylene glycol then adding specific acid or hydroxyl containing substances towards the end of the reaction. Another technique is making an acrylic functional alkyd with an acrylic monomer blend rich in carboxylic acid groups.

Ubiquitin is a highly conserved protein that is covalently linked to other proteins to regulate their function and degradation. This gene encodes a member of the ubiquitin- specific protease family of cysteine proteases. The enzyme specifically cleaves ubiquitin from ubiquitin-conjugated protein substrates. The protein is found in the nucleus and cytoplasm.

The mechanism by which the Lewis pair binds CO₂ in solution. The amount of conjugated Lewis pairs can be measured and reflects the quantity of CO₂ in solution. Inside oscillatory microfluidic tube, the Switchable Hydrophilicity Solvent (SHS) - in this case DBAE - being protonated and becoming hydrophilic. The hydrophilic state contains bound CO₂.

Polyfuran (PFu) is a polymer that consists of multiple furanylene rings. Such materials are of interest for their potential in molecular electronics, although much less studied than polythiophenes and polypyrroles. Polyfuran is distinct from furan resins, a class of non-conjugated polymers. Furan resins are of commercial interest, in contrast to polyfuran.

The term "homoaromaticity" derives from the structural similarity between homoaromatic compounds and the analogous homo-conjugated alkenes previously observed in the literature. The IUPAC Gold Book requires that Bis-, Tris-, etc. prefixes be used to describe homoaromatic compounds in which two, three, etc. sp3 centers separately interrupt conjugation of the aromatic system.

All this reactions belong to the phase I of the biotransformation process. In rats, EAA can be conjugated with glycine or may suffer O-deethylated. After this, it can be metabolized to carbon dioxide. An extra pathway in these animals involves microsomal P450 mixed function oxidases, with deethylation producing acetaldehyde and ethylene glycol.

Faisal Fulad and his BHRWS & GECHR with a number of Bahraini human rights organizations establish The Bahrain Human Rights Network (BHRN) and they launched a campaign for a personal status law for Bahraini Shiite Women, Conjugated with Human Rights Council meeting on 19 September 2012 to discuss the recommendations of Bahrain Human Rights.

The most common past tense construction in German is the haben ("to have") plus past participle (or for intransitive verbs of motion, the sein ("to be") plus past participle) form, which is a pure past construction rather than conveying perfect aspect. The past progressive is conveyed by the simple past form. The future can be conveyed by the auxiliary werden, which is conjugated for person and number; but often the simple non- past form is used to convey the future. Modality is conveyed via conjugated pre-verbal modals: müssen "to have to", wollen "to want to", können "to be able to"; würden "would" (conditional), sollten "should" (the subjunctive form of sollen), sollen "to be supposed to", mögen "to like", dürfen "to be allowed to".

New South Wales Government Railways D57 class 4-8-2, with Gresley conjugated gear visible at front below the smokebox. The longer 2 to 1 Lever is located on the right side of the locomotive, and the shorter Equal Lever on the left side. The Gresley conjugated gear is effectively an adding machine, where the position of the valve for the inside cylinder is the sum of the positions of the two outside cylinders, but reversed in direction. It can also be thought of as a rocking lever between one outside cylinder and the inside cylinder, as is common on 4-cylinder steam locomotives, but with the pivot point being moved back and forth by a lever from the other outside cylinder.

People with GS predominantly have elevated unconjugated bilirubin, while conjugated bilirubin is usually within the normal range and is less than 20% of the total. Levels of bilirubin in GS patients are reported to be from 20 μM to 90 μM (1.2 to 5.3 mg/dl) compared to the normal amount of < 20 μM. GS patients have a ratio of unconjugated/conjugated (indirect/direct) bilirubin commensurately higher than those without GS. The level of total bilirubin is often further increased if the blood sample is taken after fasting for two days, and a fast can, therefore, be useful diagnostically. A further conceptual step that is rarely necessary or appropriate is to give a low dose of phenobarbital: the bilirubin will decrease substantially.

The indirect method involves an unlabeled primary antibody (first layer) that binds to the target antigen in the tissue and a labeled secondary antibody (second layer) that reacts with the primary antibody. As mentioned above, the secondary antibody must be raised against the IgG of the animal species in which the primary antibody has been raised. This method is more sensitive than direct detection strategies because of signal amplification due to the binding of several secondary antibodies to each primary antibody if the secondary antibody is conjugated to the fluorescent or enzyme reporter. Further amplification can be achieved if the secondary antibody is conjugated to several biotin molecules, which can recruit complexes of avidin-, streptavidin- or NeutrAvidin protein-bound enzyme.

Quantum dots are unique fluorophores relative to organic dyes, like fluorescein or rhodamine because they are composed of semiconductor metals, instead of a π-conjugated carbon-bonding framework. With organic dyes, the length of the π-conjugated framework (quantum confinement), as well as side- groups (electron donating/withdrawing or halogens) tend to dictate the absorption and emission spectra of the molecule. Semiconductor quantum dots also work on the concept of quantum confinement, (often referred to as "Particle in a Box" theory) where an exciton is formed inside the crystal lattice by an incident photon of higher energy. The electron and hole of the exciton have an interaction energy that is tuned by changing the physical size of the quantum dot.

The concentrations of fatty acids in blood serum or plasma can be measured using α-parinaric acid, which will compete for binding sites on serum albumin.Berde CB, Kerner JA, Johnson JD. (1980). Use of the conjugated polyene fatty-acid parinaric-acid in assaying fatty-acids in serum or plasma. Clinical Chemistry 26(8): 1173-1177.

A mixed mutation occurs when negating conjugated verbs. Initial consonants undergo aspirate mutation if subject to it, and soft mutation if not. For example, ("I heard") and ("I said") are negated as ("I heard nothing") and ("I said nothing"). In practice, soft mutation is often used even when aspirate mutation would be possible (e.g.

In addition to antibody mediated immuno-RCA, the ssDNA RCA primer can be conjugated to the 3' end of a DNA aptamer as well. The primer tail can be amplified through rolling circle amplification. The product can be visualized through the labeling of fluorescent reporter. The process is illustrated in the figure on the right.

Words inflect for gender, number and state, using prefixes, suffixes and circumfixes. Verbs are heavily inflected, being marked for tense, aspect, mode, voice, person of the subject and polarity, sometimes undergoing ablaut. Pervasive borrowing from Arabic extends to all major word classes, including verbs; borrowed verbs, however, are conjugated according to native patterns, including ablaut.

Cyclohexadienes, many derived from Birch reduction of aromatic compounds, form derivatives (diene)Fe(CO)3. The affinity of the Fe(CO)3 unit for conjugated dienes is manifested in the ability of iron carbonyls catalyse the isomerisations of 1,5-cyclooctadiene to 1,3-cyclooctadiene. Cyclohexadiene complexes undergo hydride abstraction to give cyclohexadienyl cations, which add nucleophiles.

Many participate in phase I metabolism of xenobiotics such as toxins or drugs; the resulting carboxylates are then conjugated by other enzymes to increase solubility and eventually excreted. The carboxylesterase family of evolutionarily related proteins (those with clear sequence homology to each other) includes a number of proteins with different substrate specificities, such as acetylcholinesterases.

Adenylate cyclase toxin, or its parts, also serve as a tool for cell biologists. The AC domain finds use as a reporter protein. This reporter activity is based on activating cAMP production if translocated into a cell, conjugated to a studied protein. The AC domain consists of two subdomains, both are required for cAMP production.

The name was derived from the Latin vacca (cow). Vaccenic acid was discovered in 1928 in animal fats and butter. Mammals convert it into rumenic acid, a conjugated linoleic acid, where it shows anticarcinogenic properties. Its stereoisomer, cis-vaccenic acid, is an omega-7 fatty acid, is found in Sea Buckthorn (Hippophae rhamnoides) oil.

Codeine-6-glucuronide (C6G) is a major active metabolite of codeine and may be responsible for as much as 60% of the analgesic effects of codeine. C6G exhibits decreased immunosuppressive effects compared to codeine. During its metabolism, codeine is conjugated with glucuronic acid by the enzyme UDP- Glucuronosyltransferase-2B7 (UGT2B7) to form codeine-6-glucuronide.

In Kannada, there cannot be more than one finite, or conjugated, verb in the sentence. For example, the sentence 'I went to school and came home.' cannot be literally translated into Kannada. The Kannada equivalent of that sentence would be 'Having gone to school, I came home.' In Kannada, adverbial participles must be used.

Korean verbs are conjugated. Every verb form in Korean has two parts: a verb stem, simple or expanded, plus a sequence of inflectional suffixes. Verbs can be quite long because of all the suffixes that mark grammatical contrasts. A Korean verb root is bound, meaning that it never occurs without at least one suffix.

Verbs also have derivational morphology. They mark for past, present, and future tense, as well as for certainty, doubt, and non-factual, hypothetical, incredulative, and admonative statements. Imperatives may also be conjugated as a hortative. Tiriyó has a wide variety of adverbial forms, and a variety of postpositions including directional, locative, perlative, relational, and experiencer.

Verbs can be conjugated from the infinitive into the present tense, the past singular, the past plural and the past participle. There exist strong and weak verbs in Mercian that too conjugate in their own ways. The future tense requires an auxiliary verb, like will (Mercian wyllen). There are three moods: indicative, subjunctive and imperative.

Similarly, b indicates one carbon and c indicates two carbons. While indenofluorenes are members of the polycyclic hydrocarbon family, they are not necessarily members of the polycyclic aromatic hydrocarbon family. For example, the fully conjugated versions, shown below, have 20π electrons making them formally anti-aromatic. First indenofluorene scaffold synthesized by Dr. Gabriel in 1884.

TFAs are classified as conjugated and nonconjugated, corresponding usually to the structural elements -CH=CH-CH=CH- and -CH=CH-CH2-CH=CH-, respectively. Nonconjugated TFAs are represented by elaidic acid and linolelaidic acid. Their presence is linked heart diseases. The TFA vaccenic acid, which is of animal origin, poses less of a health risk.

The phrase Allez-vous-en is a French phrase meaning Go away directed to one or more persons with whom one is not familiar. Its more familiar translation is va t´en. The phrases are formed using the reflexive conjugated form of the verb aller which means to go, and the object pronoun en.

Phosphomolybdic is used as a stain for developing thin-layer chromatography plates, staining phenolics, hydrocarbon waxes, alkaloids, and steroids. Conjugated unsaturated compounds reduce PMA to molybdenum blue. The color intensifies with increasing number of double bonds in the molecule being stained. Phosphomolybdic acid is also occasionally used in acid-catalyzed reactions in organic synthesis.

Maleic anhydride is produced by vapor- phase oxidation of n-butane. The overall process converts the methyl groups to carboxylate and dehydrogenates the backbone. The selectivity of the process reflects the robustness of maleic anhydride, with its conjugated double-bond system. Traditionally maleic anhydride was produced by the oxidation of benzene or other aromatic compounds.

Related estrogens such as ethinylestradiol, which is the most common estrogen in birth control pills, and conjugated estrogens (brand name Premarin), which is used in menopausal hormone therapy, are used as medications as well. In 2017, it was the 61st most commonly prescribed medication in the United States, with more than twelve million prescriptions.

Phosphorothioate ASOs can delivered to cells without the need of a delivery vehicle. ASOs do not penetrate the blood brain barrier when delivered systemically but they can distribute across the neuraxis if injected in the cerebrospinal fluid typically by intrathecal administration. Newer formulations using conjugated ligands greatly enhances delivery efficiency and cell-type specific targeting.

A follow-on drug to Inotersen is being developed by Ionis Pharmaceuticals and under license to Akcea Therapeutics for hereditary transthyretin-mediated amyloidosis. In this formulation the ASO is conjugated to N-Acetylgalactosamine enabling hepatocyte-specific delivery, greatly reducing dose requirements and side effect profile while increasing the level of transthyretin reduction in patients.

DNCB is used as a substrate in GST enzyme activity assays. The molecule is conjugated to a single molecule of reduced glutathione which then absorbs at 340 nm. Affinity of CDNB for each class of GST varies and so it is not a good measure of activity for some forms (e.g. GSTT and GSTZ).

Evidence from the Rig Veda (the earliest attestation of Sanskrit) indicates that secondary verbs in PIE were not conjugated in the subjunctive or optative moods. This suggests that these moods follow the same constraint, and are derivational in origin. The later Indo-European languages worked around these limitations, but each in their own way.

Subsequent dimerisation or multimerisation can increase plasma half-life and, due to avidity, affinity to the target protein. Alternatively, multispecific Affilin molecules can be generated, binding different targets simultaneously. Radionuclides or cytotoxins can be conjugated to Affilin proteins, making them potential tumour therapeutics and diagnostics. Conjugation of cytokines has also been tested in vitro.

It has been proposed to be conjugated from arachidonoyl-CoA or arachidonoyl phospholipids and dopamine, but in vitro experiments do not support this theory. However, the indirect biosynthesis of phospholipid esters with dopamine may be possible, as dopamine can induce the aminolysis of the glycerol-fatty acid bonds in phospholipid chains (arachidonoyl, palmitoyl, linoleyl, etc.).

Vaccination using capsular material is effective against some organisms (e.g., H. influenzae type b, S. pneumoniae, and N. meningitidis). However, polysaccharides are not highly antigenic, especially in children, so many capsular vaccines contain polysaccharides conjugated with protein carriers, such as the tetanus toxoid or diphtheria toxoid. This stimulates a much more robust immune response.

Sex and reproduction are separate in ciliates. C. uncinata is capable of mating with other C. uncinata cells that have the same mating type. After mating type complementary, the germ-line nucleus undergoes meiosis to produce zygotic nuclei. Each conjugated cell transfers one zygotic nucleus to the other cell where the zygotic nuclei fuse.

The society and Gulf European Center of Human Rights with a number of Bahraini human rights organizations established the Bahrain Human Rights Network and they launched a campaign for a personal status law for Bahraini Shiite Women, Conjugated with Human Rights Council meeting on 19 September 2012 to discuss the recommendations of Bahrain Human Rights.

Punicic acid (also called trichosanic acid) is a polyunsaturated fatty acid, 18:3 cis-9, trans-11, cis-13. It is named for the pomegranate, (Punica granatum), and is obtained from pomegranate seed oil. It is also found in the seed oils of snake gourd. Punicic acid is a conjugated linolenic acid or CLnA; i.e.

The conductivity of such polymers is the result of several processes. For example, in traditional polymers such as polyethylenes, the valence electrons are bound in sp3 hybridized covalent bonds. Such "sigma- bonding electrons" have low mobility and do not contribute to the electrical conductivity of the material. However, in conjugated materials, the situation is completely different.

Medrogestone synthesis. Reduction of the conjugated 16,17 double bond of 6-methyl-16-dehydropregnenolone acetate by means of lithium in liquid ammonia leads initially to the 17 enolate ion; this is alkylated in situ with methyl iodide. The now-familiar steric control asserts itself to afford the 17α-methyl compound,. The acetate group is lost as a side reaction.

17α-Dihydroequilenin, or α-dihydroequilenin, also known as 6,8-didehydro-17α-estradiol, as well as estra-1,3,5(10),6,8-pentaen-3,17α-diol, is a naturally occurring steroidal estrogen found in horses which is closely related to equilin, equilenin, and 17α-estradiol, and, as the 3-sulfate ester sodium salt, is a minor constituent (1.2%) of conjugated estrogens (Premarin).

Immunoconjugates are antibodies conjugated (joined) to a second molecule, usually a toxin, radioisotope or label. These conjugates are used in immunotherapy and to develop monoclonal antibody therapy as a targeted form of chemotherapy when they are often known as antibody-drug conjugates. When the conjugates include a radioisotope see radioimmunotherapy. When the conjugates include a toxin see immunotoxin.

PDX is an isomer of (and sometimes confused with) neuroprotectin D1 (NPD1; i.e. 10R,17S-dihydroxy-4Z,7Z,11E,13E,15Z,19Z-doxahexaenoic acid; also termed protectin D1 [PD1]). NPD1 is structurally identical to PDX except that its three conjugated double bonds have the E,E,Z configuration as opposed to the E,Z,E configuration of PDX.

This definition excludes specifically the trans fats (vaccenic acid and conjugated linoleic acid) that are present especially in human milk, dairy products, and beef. In 2018 the World Health Organization launched a plan to eliminate trans fat from the global food supply. They estimate that trans fat leads to more than 500,000 deaths from cardiovascular disease yearly.

Ligands can also be attached to the surface of a nanoparticle to target certain receptors located within the brain. Once the nanoparticle is through the blood brain barrier it releases the drug into the brain. A specific example of this solution is the delivery of anti-HIV drugs to the central nervous system by TAT-conjugated nanoparticles.

Oxidation of senecionine to its respective dehydropyrrolizidine is responsible for its toxic effects. In the toxic pathway, the 2-pyrroline in the core is desaturated via an oxidation reaction to form a pyrrolic ester. This metabolite can still subsequently be eliminated if it is conjugated to glutathione. However, this metabolite is toxic because it can act as an electrophile.

If these groups are in direct conjugation with the pi-system of the chromophore, they may increase the wavelength at which the light is absorbed and as a result intensify the absorption. A feature of these auxochromes is the presence of at least one lone pair of electrons which can be viewed as extending the conjugated system by resonance.

Reconstruction of off-axis holograms is done numerically and it consists of two mathematical transformations. First, a Fourier transform of the hologram is performed. The resulting complex image consists of the autocorrelation (center band) and two mutually conjugated sidebands. Only one side band is selected by applying a low-pass filter (round mask) centered on the chosen side-band.

Increased conjugated hyperbilirubinemia is the hallmark for diagnosing Rotor syndrome. There is no distinct black pigmentation of the liver as seen in a similar, Dubin-Johnson Syndrome. Genes, SLCO1B1 and SLCO1B3 that result in complete functional deficiencies of both protein products (OATP1B1 and OATP1B3, respectively), are also present. Rotor syndrome is largely a diagnosis of exclusion.

Metal nanoparticles are chemically synthesized using reduction reactions. For example, drug-conjugated silver nanoparticles are created by reducing silver nitrate with sodium borohydride in the presence of an ionic drug compound. The drug binds to the surface of the silver, stabilizing the nanoparticles and preventing the nanoparticles from aggregation. Metallic nanoparticles typically cross the BBB via transcytosis.

The catalytic enzyme has been isolated in the human liver mitochondria. Furthermore, phenylacetylglutamine has been found in human urine, but not in the excretory material of rats, dogs, cats, monkeys, sheep, or horses. Throughout the metabolic process, phenylacetylglutamine is bound and conjugated by free-plasma in the kidney to remove excess nitrogen through its excretion in the urine.

As a typical right-headed subject–object–verb language, verbs are typically the last element in a Korean sentence, and the only one necessary. That is, a properly conjugated verb can form a sentence by itself. The subject and the object of a sentence are often omitted when these are considered obvious in context. For example, the sentence: chac.ass.

Since 1947, BHA has been added to edible fats and fat-containing foods for its antioxidant properties as it prevents rancidification of food which creates objectionable odors. Like butylated hydroxytoluene (BHT), the conjugated aromatic ring of BHA is able to stabilize free radicals, sequestering them. By acting as free radical scavengers, further free radical reactions are prevented.

Early in his career, Burroughes discovered that certain conjugated polymers were capable of emitting light when an electric current passed through them. The discovery of this previously unknown form of electroluminescence led to the foundation of Cambridge Display Technology where Burroughes has been responsible for a number of technology innovations, including the direct printing of full-colour OLED displays.

Dimethyl acetylenedicarboxylate (DMAD) is an organic compound with the formula CH3O2CC2CO2CH3. It is a di-ester in which the ester groups are conjugated with a C-C triple bond. As such, the molecule is highly electrophilic, and is widely employed as a dienophile in cycloaddition reactions, such as the Diels- Alder reaction. It is also a potent Michael acceptor.

M. Irie, Chem. Rev. 2000 , 100, 1685. The closed form has a conjugated path from one end of the molecule to the other, whereas the open form has not. This allows for the electronic communication between functional groups attached to the far ends of the diarylethene to be switched on and off using UV and visible light.

It is recommend that primary immunization against meningococcal disease with NmVac4 for all young adolescents at 11–12 years of age and all unvaccinated older adolescents at 15 years of age. Although NmVac4 is the preferred meningococcal vaccine in adolescents 11 years of age or older, NmVac4 is an acceptable alternative if the conjugated vaccine is unavailable.

A conventional FPIA follows the procedure below: # A specific quantity of sample is added to reaction buffer. # The solution is allowed to equilibrate at room temperature for approximately two minutes. # The solution is evaluated in a fluorescence polarization analyzer to gather a baseline measurement. # A specific quantity of antigen conjugated with fluorophore is added to the solution.

An α,β-unsaturated acid is a type of an α,β-unsaturated carbonyl that consists of an alkene conjugated to a carboxylic acid. The simplest example is acrylic acid (CH2=CHCO2H). These compounds are prone to polymerization, giving rise to the large area of acrylate plastics. Acrylates are derived from but do not contain the acrylate group.

This is a direct result of increasing entropy, which only can be reverted if a priori knowledge is used to reconstruct a phase-matched wave- front such as with phase conjugated mirrors. Conservation of etendue can be derived in different contexts, such as from optical first principles, from Hamiltonian optics or from the second law of thermodynamics.

Satirises "as seen on TV" sales strategies. The title is a reference to the phone number of one of such services, well known in Brazil at the time. The song also includes several English words such as money, good, work, have, and play. The latter 3 being conjugated in Portuguese as verbs, like "Workando" meaning "working".

The separation of β-carotene from the mixture of other carotenoids is based on the polarity of a compound. β-Carotene is a non-polar compound, so it is separated with a non-polar solvent such as hexane. Being highly conjugated, it is deeply colored, and as a hydrocarbon lacking functional groups, it is very lipophilic.

A rather intuitive route to cyclic isomers is the intramolecular conjugate addition to α,β–unsaturated carbonyls (intramolecular Michael addition or IMA). Competent Michael acceptors include conjugated enones, enals or nitroalkene derivatives and examples of other acceptors are sparse.Nodes, W. J.; Nutt, D. R.; Chippindale, A. M.; Cobb, A. J. A. J. Am. Chem. Soc. 2009, 131, 16016–16017.

This tree once provided the timber for the spars of canoes. The ovoid fruit which this tree bears have been used for medicinal purposes (Truk Is.), or as a glue and varnish in food bowl manufacture (Solomon Is.). Its seeds are a major source of alpha-Parinaric acid, a conjugated polyunsaturated fatty acid with various uses.

Negative verbs are conjugated differently from positive ones (as in English "he goes" and "he does not go") in many tenses, otherwise adding only the negative to the positive conjugation. Grammatically, early forms of Armenian had much in common with classical Greek and Latin, but the modern language, like modern Greek, has undergone many transformations, adding some analytic features.

This has then been shown to be a prospective cancer therapy drug that can not only be conjugated to paclitaxel but also peptides, monoclonal antibodies, siRNA and many other biological materials. Paclitaxel trevatide has the potential to treat a variety of CNS diseases including glioma. Research has shown reduction in tumor growth in mice and rats with glioblastoma.

Pentacene is a polycyclic aromatic hydrocarbon consisting of five linearly- fused benzene rings. This highly conjugated compound is an organic semiconductor. The compound generates excitons upon absorption of ultra-violet (UV) or visible light; this makes it very sensitive to oxidation. For this reason, this compound, which is a purple powder, slowly degrades upon exposure to air and light.

This method is suitable for the determination of iodine value in conjugated systems (ASTM D1541). It has been observed that Wijs/ Hanuš method gives erratic values of IV for some sterols (i.e. cholesterol) and other unsaturated components of insaponifible fraction. The original method uses pyridine dibromide sulfate solution as halogenating agent and an incubation time of 5 min.

In 1929, Adolf Butenandt and Edward Adelbert Doisy independently isolated and purified estrone, the first estrogen to be discovered. Then, estriol and estradiol were discovered in 1930 and 1933, respectively. Shortly following their discovery, estrogens, both natural and synthetic, were introduced for medical use. Examples include estriol glucuronide (Emmenin, Progynon), estradiol benzoate, conjugated estrogens (Premarin), diethylstilbestrol, and ethinylestradiol.

Calendic acid is an omega-6 fatty acid. though not usually listed with this group. Calendic acid is synthesised in Calendula officinalis from linoleate by an unusual Δ12-oleate desaturase (a FAD 2 variant) that converts the cis-double bond at position 9 to a trans,trans-conjugated double bond system. An all-trans beta isomer has been described.

Arias was born in Palo Alto, California. She studied physics at the Federal University of Paraná in Brazil, where she earned her master's degree in 1997. Arias moved to the United Kingdom as a graduate student, where she worked in the research group of Richard Friend. Her doctoral research involved investigations into phase-separation within conjugated polymer thin films.

Fatty acids such as conjugated linoleic acid, catalpic acid, eleostearic acid and punicic acid, in addition to providing energy, represent potent immune modulatory molecules. Saturated fats (typically from animal sources) have been a staple in many world cultures for millennia. Unsaturated fats (e. g., vegetable oil) are considered healthier, while trans fats are to be avoided.

Miura et al. reported the cross coupling of vinyl bromides with an alkenyl carboxylic acid using a palladium catalyst. Some of the conjugated dienes prepared were reported to exhibit solid state fluorescence. Yamashita M, Hirano K, Satoh T, Miura M. Synthesis of α,ω-diarylbutadienes and-hexatrienes via decarboxylative coupling of cinnamic acids with vinyl bromides under palladium catalysis.

Several letters are ambiguous in these languages, such as voiced consonants which lose their voice when appearing at the end of a word. These ambiguities are avoided writing Rheinische Dokumenta; despite the fact that word stems may change their printed appearance, when declined or conjugated, always the most phonetically correct letters, digraphs, or trigraphs are being used.

As in all Northern Kimberley languages, they contain phenomena of simple and compound verbs, utilizing auxiliaries through conjugation: "certain verbs are conjugated by means of prefixes for person (and to a lesser degree tense), while suffixes are added to show aspect, mood, tense and voice." All Worrorran derived languages contain nominal classification, head-marking, and complex predication.

The most commonly used MHC multimers are tetramers. These are typically produced by biotinylating soluble MHC monomers, which are typically produced recombinantly in eukaryotic or bacterial cells. These monomers then bind to a backbone, such as streptavidin or avidin, creating a tetravalent structure. These backbones are conjugated with fluorochromes to subsequently isolate bound T-cells via flow cytometry.

However, extensive purpura without any hemorrhagic disorder has been reported. The presence of less florid lesions on the trunk does not exclude the diagnosis. Lymphadenopathy and hepatomegaly are sometimes noted. Raised AST and ALT levels with no rise in conjugated and unconjugated bilirubin levels are sometimes detectable, although the absence of such does not exclude the diagnosis.

Tropolone had been recognised as an aromatic molecule by Dewar in 1945. In 1936, Hückel developed the theory of π-conjugated biradicals (non-Kekulé molecules). The first example, known as the Schlenk-Brauns hydrocarbon, had been discovered in the same year. The credit for explaining such biradicals is usually given to Christopher Longuet-Higgins in 1950.

While some observational studies had suggested that estrogens increase the risk for gallbladder disease by as much as twofold to fourfold, such an association had not been reported consistently. More recent randomized clinical trial data among postmenopausal women now support a causal role for oral menopausal hormone therapy estrogens. Confirming the positive finding of another large study, the landmark Women's Health Initiative (WHI) reported very significant increases (p < 0.001) for risk of gallbladder disease or surgery attributed to treatments with both estrogen alone (conjugated equine estrogen; CEE) and estrogen-plus-progestin (conjugated equine estrogen with medroxyprogesterone; CEE+MPA ). Specifically, a 67% increase (CEE versus placebo) and 59% increase (CEE+MPA versus placebo) among healthy postmenopausal women that reported either having had a hysterectomy (n = 8376) or not (n = 14203) prior to randomization, respectively.

LNER Class V2 4771 Green Arrow. Note Gresley conjugated valve gear located ahead of the piston valves, driven from the valve spindles The Gresley conjugated valve gear is a valve gear for steam locomotives designed by Sir Nigel Gresley, chief mechanical engineer of the LNER, assisted by Harold Holcroft. It enables a three-cylinder locomotive to operate with only the two sets of valve gear for the outside cylinders, and derives the valve motion for the inside cylinder from them by means of levers (the "2 to 1 lever" and "equal lever").Restoration of Gresley A4 #60019 Bittern Diagram of Gresley and Walschaerts valve gear arrangement on LNER A4 locomotive - retrieved 4 October 2006 The gear is sometimes known as the Gresley-Holcroft gear, acknowledging Holcroft's major contributions to its development.

In Kabardian, like all Northwest Caucasian languages, the verb is the most inflected part of speech. Verbs are typically head final and are conjugated for tense, person, number, etc. Some of Circassian verbs can be morphologically simple, some of them consist only of one morpheme, like: кӏуэ "go", щтэ "take". However, generally, Circassian verbs are characterized as structurally and semantically difficult entities.

The biochemical mechanism by which α-parinaric acid is formed in the plant Impatiens balsamina was elaborated using techniques of molecular biology. The enzyme responsible for the creation of the conjugated double bonds was identified using expressed sequence tags, and called a "conjugase". This enzyme is related to the family of fatty acid desaturase enzymes responsible for putting double bonds into fatty acids.

An example of a reactivated aulacogen is the East African Rift or the Ottawa-Bonnechere Graben in Ontario and Quebec, Canada, an ancient aulacogen that reactivated during the breakup of Pangaea. Abandoned rift basins that have been uplifted and exposed onshore, like the Lusitanian Basin, are important analogues of deep- sea basins located on conjugated margins of ancient rift axes.

Dieldrin can then be directly oxidized by cytochrome oxidases, which forms 9-hydroxydieldrin. An alternative for oxidation involves the opening of the epoxied ring by epoxied hydrases, which forms the product 6,7-trans-dihydroxydihydroaldrin. Both products can be conjugated to form 6,7-trans-dihydroxydihydroaldrin glucuronide and 9-hydroxydieldrin glucuronide, respectively. 6,7-trans-dihydroxydihydroaldrin can also be oxidized to form aldrin dicarboxylic acid.

DPP has high stability to heat but not very well to acid and base. The alkylation of amide groups improves the solubility. The modified DDP shows high fluorescence and the emission wavelength is adjustable by change the aromatic group at 3 and 6 positions. Both electron donor group, such as thiophene, and expanding of the conjugated system increase the emission wavelength.

Nuclear actin exists mainly as a monomer, but can also form dynamic oligomers and short polymers. Nuclear actin organization varies in different cell types. For example, in Xenopus oocytes (with higher nuclear actin level in comparison to somatic cells) actin forms filaments, which stabilize nucleus architecture. These filaments can be observed under the microscope thanks to fluorophore-conjugated phalloidin staining.

In Adyghe, like all Northwest Caucasian languages, the verb is the most inflected part of speech. Verbs are typically head final and are conjugated for tense, person, number, etc. Some of Circassian verbs can be morphologically simple, some of them consist only of one morpheme, like: кӏо "go", штэ "take". However, generally, Circassian verbs are characterized as structurally and semantically difficult entities.

Mesomeric effect can be transmitted along any number of carbon atoms in a conjugated system. This accounts for the resonance stabilization of the molecule due to delocalization of charge. It is important to note that the energy of the actual structure of the molecule, i.e. the resonance hybrid, may be lower than that of any of the contributing resonance structures.

Spanish verbs are a complex area of Spanish grammar, with many combinations of tenses, aspects and moods (up to fifty conjugated forms per verb). Although conjugation rules are relatively straightforward, a large number of verbs are irregular. Among these, some fall into more-or-less defined deviant patterns, whereas others are uniquely irregular. This article summarizes the common irregular patterns.

Like all carotenoids, lycopene is a tetraterpene. It is insoluble in water. Eleven conjugated double bonds give lycopene its deep red color. Owing to the strong color, lycopene is useful as a food coloring (registered as E160d) and is approved for use in the USA, Australia and New Zealand (registered as 160d)Australia New Zealand Food Standards Code and the European Union.

French, like some other Romance languages, does not have a grammatically distinct class of modal auxiliary verbs; instead, it expresses modality using conjugated verbs followed by infinitives: for example, pouvoir "to be able" (Je peux aller, "I can go"), devoir "to have an obligation" (Je dois aller, "I must go"), and vouloir "to want" (Je veux aller "I want to go").

After oral ingestion, senecionine is absorbed from the gastrointestinal tract. When it reaches the liver, it is metabolized via three pathways: N-oxidation, oxidation, and ester hydrolysis. N-oxidation and hydrolysis are detoxification pathways, and the products of these reactions are conjugated and excreted by the kidneys. However, the N-oxide may be converted back into senecionine by cytochrome P-450 (CYP450) monooxygenases.

To circumvent the latter issue, experiments has shown that fullerenes could be a good candidate for use instead of sulfur because of the large conjugated π-system that can electrically contact many more atoms at once than one atom of sulfur.Sørensen, J.K. . (2006). "Synthesis of new components, functionalized with (60)fullerene, for molecular electronics". 4th Annual meeting – CONT 2006, University of Copenhagen.

Woodward−Fieser rules estimate the shift in wavelength of maximum absorption for several auxochromes attached to a conjugated system in an organic molecule. An auxochrome helps a dye to bind to the object that is to be colored. Electrolytic dissociation of the auxochrome group helps in binding and it is due to this reason a basic substance takes an acidic dye.

Jeffries-EL served as a Martin Luther King visiting professor at Massachusetts Institute of Technology between 2014 and 2015. Here, her group focused on the synthesis of polymer building blocks, including heterocyclic electron-rich (donor) and electron-poor (acceptor) units. For electron-deficient units, Jeffries-EL develops benzobisazoles. She is interested in cross-conjugated organic semiconductors, including benzodifurans, as well as functional Polythiophenes.

Verbs are conjugated for tense and aspect, but not for person. That is, they record distinctions like "I am, I was, I would", but not like "I am, we are, s/he is". Conjugation relies exclusively on infixes, which are like suffixes but go inside the verb. "To hunt", for example, is taron, but "hunted" is taron, with the infix '.

The orthography of the Mongolian Latin is based on the orthography of the Classical Mongolian script. It preserves short final vowels. It does not drop unstressed vowels in the closing syllables when the word is conjugated. The suffixes and inflections without long or i-coupled vowels are made open syllables ending with a vowel, which is harmonized with the stressed vowel.

The Romanian verb ("to be") is suppletive and irregular, with the infinitive coming from Latin fieri, but conjugated forms from forms of Latin sum. For example, ("I am"), ("you are"), ("I have been"), ("I used to be"), ("I was"); while the subjunctive, also used to form the future in ("I will be/am going to be"), is linked to the infinitive.

The classical immunoprecipitation technique is then applied: magnetic beads conjugated to anti-mouse-IgG are used to bind the anti-5mC antibodies, and unbound DNA is removed in the supernatant. To purify the DNA, proteinase K is added to digest the antibodies and release the DNA, which can be collected and prepared for DNA detection. For more details regarding the experimental steps see.

The compound, likely in sodium sulfate form, is a component of conjugated estrogens (Premarin), a pharmaceutical extract of the urine of pregnant mares, though it is present only in small amounts in pregnant mare urine. It has been reported by possess either equivalent estrogenic activity to that of equilin or only slight estrogenic activity. The compound was first described in 1932.

In animals and humans, after ingestion, natural phenols become part of the xenobiotic metabolism. In subsequent phase II reactions, these activated metabolites are conjugated with charged species such as glutathione, sulfate, glycine or glucuronic acid. These reactions are catalysed by a large group of broad-specificity transferases. UGT1A6 is a human gene encoding a phenol UDP glucuronosyltransferase active on simple phenols.

The verbal system is the pivot of Kotava. Verbs are conjugated into three tenses (present, past, and future) and four moods (realis, imperative, conditional, and relative). In addition, there are mechanisms for voices, aspects, modalities and other nuances, permitting a great deal of subtlety in expression. There are seven persons for verbs, including an inclusive and exclusive first person plural.

Purple sulfur bacteria make conjugated pigments called carotenoids that function in the light harvesting complex. When these organisms die and sink, some pigment molecules are preserved in modified form in the sediments. One carotenoid molecule produced, okenone, is diagenetically altered to the biomarker okenane. The discovery of okenane in marine sediments implies the presence of purple sulfur bacteria during the time of burial.

Diquat is an isomer of viologens, being derived from 2,2'-bipyridine (instead of the 4,4'-isomer). It also is a potent herbicide that functions by disrupting electron-transfer. Diquat is related to viologens but is derived from 2,2'bipyridine. Extended viologens have been developed based on conjugated oligomers such as based on aryl, ethylene, and thiophene units are inserted between the pyridine units.

In 1938, Pietsch was promoted to Dr Phil with a doctoral dissertation titled: Areas that have a bundle of closed geodesic or a pair of conjugated counterparts (German:Über Flächen, die ein Bündel geschlossener Geodätischer oder ein Paar konjugierter Gegenpunkte besitzen), achieving a rerum naturalium at Humboldt University of Berlin. His doctoral advisor was Ludwig Bieberbach, the mathematician and National Socialist.

The process of scintillation is one of luminescence whereby light of a characteristic spectrum is emitted following the absorption of radiation. The emitted radiation is usually less energetic than that absorbed. Scintillation is an inherent molecular property in conjugated and aromatic organic molecules and arises from their electronic structures. Scintillation also occurs in many inorganic materials, including salts, gases, and liquids.

Old Irish has VSO word order shared by most Insular Celtic languages. Other orders are possible, especially under Bergin's Law. Verbs are all fully conjugated and have most forms typical of Indo-European languages. Personal pronouns, when used as direct objects, are prefixed to the verb with which they are associated (after other prefixes, and therefore are often referred to as infixes).

Smart polymers are not just for drug delivery. Their properties make them especially suited for bioseparations. The time and costs involved in purifying proteins might be reduced significantly by using smart polymers that undergo rapid reversible changes in response to a change in medium properties. Conjugated systems have been used for many years in physical and affinity separations and immunoassays.

In Slovenian, the verbs are conjugated for 3 persons and 3 numbers (singular, dual, and plural). There are 4 tenses (present, past, pluperfect, and future), 3 moods (indicative, imperative, and conditional) and 2 voices (active and passive). Verbs also have 4 participles and 2 verbal nouns (infinitive and supine). Not all combinations of the above are possible for every case.

Estrone sulfate (E1S) is an estrogen medication and naturally occurring steroid hormone. It is used in menopausal hormone therapy among other indications. As the sodium salt (sodium estrone sulfate), it is the major estrogen component of conjugated estrogens (Premarin) and esterified estrogens (Estratab, Menest). In addition, E1S is used on its own as the piperazine salt estropipate (piperazine estrone sulfate; Ogen).

An enone is a type of an α,β-unsaturated carbonyl that consists of an alkene conjugated to a ketone. The simplest enone is methyl vinyl ketone (butenone, CH2=CHCOCH3). Enones are typically produced using an aldol condensation or Knoevenagel condensation. Some commercially significant enones produced by condensations of acetone are mesityl oxide (dimer of acetone) and phorone and isophorone (trimers).

With regard to the overall method, FISH can be performed using direct labelling—fluorochromes are attached to the probes—or indirect labelling—the probes are labelled with biotin or digoxigenin which are then detected using fluorescently-labelled streptavidin or antibodies, respectively. CISH is performed using indirect labelling in which antibodies or streptavidin are conjugated to enzymes such as HRP or alkaline phosphatase (AP).

Initially, the symptoms of biliary atresia are indistinguishable from those of neonatal jaundice, a usually harmless condition commonly seen in infants. However, infants with biliary atresia develop progressive conjugated jaundice, pale white stools, and dark urine. Some infants fail to thrive as there will be a degree of fat and fat-soluble vitamin malabsorption (e.g. Vitamin K). This may cause a bleeding tendency.

"I will go soon / I am just going to go." – Damay dem. "I usually/regularly/normally/am about to go." A speaker may absolutely express that an action took place in the past by adding the suffix -(w)oon to the verb (in a sentence, the temporal pronoun is still used in a conjugated form along with the past marker).

Agonists inhibit tumor cell proliferation and induce apoptosis, which is thought to be triggered by caspase-3 activity. Antagonists promote tumor cell proliferation, but this mechanism is less understood. Sigma receptor ligands have been conjugated to nanoparticles and peptides to deliver cancer treatment to tumor cells without targeting other tissues. The success with these methods have been limited to in vitro trials.

The resulting materials have rigidly planar, highly conjugated cores. They exhibit good processing characteristics for fabrication of soft electronic devices. Aside from the NDIs, other members include the diimide derivatives of perylene-3,4:9,10-tetracarboxylic dianhydride and terrylene-3,4:11,12-tetracarboxylic dianhydride. Synthesis of symmetric and unsymmetric NDIs Naphthalene diimides (NDIs) are often fluorescent, although the intensity is sensitive to substituents.

NDIs are also redox-active, forming stable radical anions near -1.10 V vs. Fc/Fc+. Their ability to accept electrons reflects the presence of an extended conjugated ring system and the electron withdrawing groups (carbonyl centers). NDIs are used ins supramolecular chemistry due to their tendency to form charge-transfer complexes with crown ethers, e.g. to give rotaxanes and catenanes.

AzM also may undergo glutathione- catalyzed dearylation which forms DMPDT and glutathione-conjugated mercaptomethyl benzazimide (reaction 5 in figure 2) Gutoxon, the compound that mainly causes AzM to be toxic, can also be detoxified. Gutoxon can again be detoxified with the help of CYP450. CYP450 catalyzes the oxidative cleavage of gutoxon, which than yields DMP and MMBA (reaction 6 in figure 2).

Portuguese originally constructed progressive tenses with a conjugated form of the verb "to be", followed by the gerund of the main verb, like English: e.g. Eu estou trabalhando "I am working" (cf. also the corresponding Italian phrase: (Io) sto lavorando). However, in European Portuguese an alternative construction has appeared, formed with the preposition a followed by the infinitive of the main verb: e.g.

1,1-disubstituted and tetrasubstituted epoxides also follow this principle. File:NitrileCollin.png Conjugated nitriles containing γ hydrogens may be deprotonated at the γ position to give resonance-stabilized anions. These intermediates almost always react with α selectitivity in alkylation reactions, the exception to the rule being anions of ortho-tolyl nitriles. File:Tolunitrile.png Formation of cyanohydrins from carbonyl compounds renders the former carbonyl carbon acidic.

Others have argued that a hCG laced vaccine could not be used for sterilization since the effects of the anti-fertility vaccines are reversible (requiring booster doses to maintain immunity) and a non-conjugated vaccine is likely to be ineffective. Finally, independent testing of the tetanus vaccine by Kenya's health authorities has revealed no traces of the human chorionic gonadotropin hormone.

OLED organic materials can be divided into two major families: small-molecule-based and polymer-based. Small molecule OLEDs (SM-OLEDs) include organometallic chelates(Alq3), fluorescent and phosphorescent dyes, and conjugated dendrimers. Fluorescent dyes can be selected according to the desired range of emission wavelengths; compounds like perylene and rubrene are often used. Very recently, Dr. Kim J. et al.

However the Wittig reagent can tolerate many other variants. It may contain alkenes and aromatic rings, and it is compatible with ethers and even ester groups. Even C=O and nitrile groups can be present if conjugated with the ylide- these are the stabilised ylides mentioned above. Bis-ylides (containing two P=C bonds) have also been made and used successfully.

Various specialized properties of molecular crystals and organic polymers with conjugated systems are of interest depending on applications, e.g. thermo-mechanical and electro-mechanical such as piezoelectricity, electrical conductivity (see conductive polymers and organic semiconductors), and electro-optical (e.g. non-linear optics) properties. For historical reasons, such properties are mainly the subjects of the areas of polymer science and materials science.

Cyanines are defined as "synthetic dyes with the general formula R2N[CH=CH]nCH=N+R2↔R2N+=CH[CH=CH]nNR2 (n is a small number) in which the nitrogen and part of the conjugated chain usually form part of a heterocyclic system, such as imidazole, pyridine, pyrrole, quinoline and thiazole." Cyanines are used in industry biotechnology (labeling, analysis, biomedical imaging).

Kangaroo meat at an Australian supermarket Kangaroo steak Kangaroo with thyme served in Helsinki, Finland. Richfield, Wisconsin, United States The kangaroo has been historically a staple source of protein for indigenous Australians. Kangaroo meat is high in protein and low in fat (about 2%). Kangaroo meat has a very high concentration of conjugated linoleic acid (CLA) when compared with other foods.

MG132 is a potent, reversible, and cell-permeable proteasome inhibitor (Ki = 4 nM). It belongs to the class of synthetic peptide aldehydes. It reduces the degradation of ubiquitin-conjugated proteins in mammalian cells and permeable strains of yeast by the 26S complex without affecting its ATPase or isopeptidase activities. MG132 activates c-Jun N-terminal kinase (JNK1), which initiates apoptosis.

Ngäbere verbs do not need to agree with their subject — verbs are inflected only for tense, not person. “Ngäbere verbs do not display subject or object agreement. In this way they differ from verbs in related Chibchan languages”. While the verbs are conjugated solely in respect to time, linguistic treatment of time is somewhat more complex in Ngäbere than in English.

Spiro-mero photochromism. One of the oldest, and perhaps the most studied, families of photochromes are the spiropyrans. Very closely related to these are the spirooxazines. For example, the spiro form of an oxazine is a colorless leuco dye; the conjugated system of the oxazine and another aromatic part of the molecule is separated by a sp³-hybridized "spiro" carbon.

In Adyghe, like all Northwest Caucasian languages, the verb is the most inflected part of speech. Verbs are typically head final and are conjugated for tense, person, number, etc. Some of Circassian verbs can be morphologically simple, some of them consist only of one morpheme, like: кӏо "go", штэ "take". However, generally, Circassian verbs are characterized as structurally and semantically difficult entities.

In polyubiquitin-C, the C-terminus of a given ubiquitin molecule is covalently conjugated to either the N-terminal residue or one of seven lysine residues of another ubiquitin molecule. Different linking of ubiquitin chains results in distinct conformations. There are 8 linkage types of polyubiquitin-C, and each type possesses the linkage-dependent dynamics and a linkage-specific conformation.

As a result, it may be beneficial to breast development for thin transgender women to gain some weight in the early phases of hormone therapy. Different estrogens, such as estradiol valerate, conjugated estrogens, and ethinylestradiol, appear to produce equivalent results in terms of breast sizes in transgender women. The sudden discontinuation of estrogen therapy has been associated with onset of galactorrhea (lactation).

Vorsetuzumab mafodotin (SGN-75) is an antibody-drug conjugate (ADC) directed to the protein CD70 designed for the treatment of cancer.Statement On A Nonproprietary Name Adopted By The USAN Council: Vorsetuzumab Mafodotin, American Medical Association. It is a humanized monoclonal antibody, vorsetuzumab, conjugated with noncleavable monomethyl auristatin F (MMAF), a cytotoxic agent. This drug was developed by Seattle Genetics, Inc.

Three categories of biodegradable CP composites have been established in relation their chemistry makeup. The first category includes partially biodegradable CP blends of conductive and biodegradable polymeric materials. The second category includes conducting oligomers of biodegradable CPs. The third category is that of modified and degradable monpmer units along with use of degradable conjugated links for use in biodegradable CPs polymers.

Synthesis of symmetric and unsymmetric NDIs. NTCDI is redox-active, forming stable radical anions near -1.10 V vs. Fc/Fc+. Its ability to accept electrons reflects the presence of an extended conjugated ring system and the electron withdrawing groups (carbonyl centers). NDI is used in supramolecular chemistry owing to its tendency to form charge-transfer complexes with crown ethers, e.g.

For many PAHs it has been proven that they are conjugated, in phase II, with either glucuronide, sulfate or glutathione. More research on this topic is necessary for benzo[c]fluorene. Glucuronide and sulfate conjugates of PAH metabolites are generally excreted in the bile and urine. Glutathione conjugates are further metabolized to mercapturic acids in the kidney and are excreted in the urine.

Depatuxizumab mafodotin (INN; development code ABT-414) is an antibody-drug conjugate designed for the treatment of cancer.Statement On A Nonproprietary Name Adopted By The USAN Council - Depatuxizumab Mafodotin, American Medical Association. It is composed of an EGFR IGg1 monoclonal antibody (depatuxizumab) conjugated to the tubulin inhibitor monomethyl auristatin F via a stable maleimidocaproyl link. This drug was developed by AbbVie.

Due to the unique temperature-dependent phase transition experienced by ELPs, in which they move from a linear state to a spherical aggregate state above their Tt, as well as the ability of ELPs to be easily conjugated with other compounds, these biopolymers hold numerous applications. Some of these applications involve ELP use in protein purification, cancer therapy, and tissue scaffolding.

This explains why one lorazepam dose, despite its shorter serum half- life, has more prolonged peak effects than an equivalent diazepam dose. Lorazepam is rapidly conjugated at its 3-hydroxy group into lorazepam glucuronide which is then excreted in the urine. Lorazepam glucuronide has no demonstrable CNS activity in animals. The plasma levels of lorazepam are proportional to the dose given.

Harry Laurence Anderson, FRS is a British chemist in the Department of Chemistry, University of Oxford. He is well known for his contributions in the syntheses of supramolecular systems (porphyrin nanorings and nanowires), exploration of the extraordinary physical properties of large pi-conjugated systems, and synthesis of cyclo[18]carbon. He is a Professor of Chemistry at Keble College, Oxford.

Estriol was discovered in 1930. Subsequently, it was introduced for medical use in oral and transdermal formulations under brand names such as Estriol, Oestrosalve, Theelol, and Tridestrin. In addition, conjugated estriol, containing mainly estriol glucuronide, was marketed in the 1930s, under the brand names Emmenin and Progynon. They were the first orally active estrogen preparations to be introduced in medicine.

Although estrone has been widely marketed in the past, it has mostly been discontinued and remains available in only a few countries. These countries reportedly include Canada, Georgia, Monaco, and Taiwan. However, estrone remains widely available throughout the world in the form of estrone sulfate, which can be found in estropipate (piperazine estrone sulfate), conjugated estrogens (Premarin), and esterified estrogens (Estratab, Menest).

Nick translation is used to label the DNA and involves cutting DNA and substituting nucleotides labelled with fluorophores (direct labelling) or biotin or oxigenin to have fluophore conjugated antibodies added later (indirect labelling). It is then important to check fragment lengths of both test and reference DNA by gel electrophoresis, as they should be within the range of 500kb-1500kb for optimum hybridization.

After oxidation, hydrolysis of the organophosphate by esterases takes places. Detoxification occurs when esterase A cleaves the compound. Besides these processes, in phase I also oxidative removal of the side chains or oxidative cleavage of the leaving group can take place. The products from phase I metabolism are more hydrophilic, making it easier to be conjugated in phase II metabolism.

Oxidation of the pyrrolizidine to its respective dehydropyrrolizidine is responsible for the toxic effects. In the toxic pathway, the 2-pyrroline in the core is desaturated via an oxidation reaction to form a pyrrolic ester. This metabolite can still subsequently be eliminated if it is conjugated to glutathione. However, this metabolite is toxic because it can act as an electrophile.

Italian has synthetic forms for the indicative, imperative, conditional, and subjunctive moods. The conditional mood form can also be used for hearsay: Secondo lui, sarebbe tempo di andare "According to him, it would be [is] time to go". The indicative mood has simple forms (one word, but conjugated by person and number) for the present tense, the imperfective aspect in the past tense, the perfective aspect in the past, and the future (and the future form can also be used to express present probability, as in the English "It will be raining now"). As with other Romance languages, compound verbs shifting the action to the past from the point in time from which it is perceived can be formed by preceding a past participle by a conjugated simple form of "to have", or "to be" in the case of intransitive verbs.

The subjunctive form seldom appears outside dependent clauses. In the indicative, there are five one-word forms conjugated for person and number: one for the present tense (which can indicate progressive or non- progressive aspect); one for the perfective aspect of the past; one for the imperfective aspect of the past; a form for the pluperfect aspect that is only used in formal writing; and a future tense form that, as in Italian, can also indicate present tense combined with probabilistic modality. As with other Romance languages, compound verbs shifting the time of action to the past relative to the time from which it is perceived can be formed by preceding a past participle by a conjugated simple form of "to have". Using the past tense of the helping verb gives the pluperfect form that is used in conversation.

Compounds that have a monocyclic, planar conjugated system containing (4n + 2) π-electrons for whole numbers n are aromatic and exhibit an unusual stability. The classic example benzene has a system of six π electrons, which, together with the planar ring of C–C σ bonds containing 12 electrons and radial C–H σ bonds containing six electrons, forms the thermodynamically and kinetically stable benzene ring, the common core of the benzenoid aromatic compounds. For benzene itself, there are two equivalent conjugated contributing Lewis structures (the so-called Kekulé structures) that predominate.While the two Kekulé resonance forms contribute to most (>90%) of the π bond energy, there are also a number of other minor contributors to the wavefunction in the valence bond treatment, including the three Dewar resonance forms, and even smaller contributions from various ionic and singlet diradical forms.

In a dictionary, the lemma "go" represents the inflected forms "go", "goes", "going", "went", and "gone". The relationship between an inflected form and its lemma is usually denoted by an angle bracket, e.g., "went" < "go". Of course, the disadvantage of such simplifications is the inability to look up a declined or conjugated form of the word, but some dictionaries, like Webster's Dictionary, list "went".

The monomer repeat unit of unsubstituted polythiophene. Polythiophenes demonstrate interesting optical properties resulting from their conjugated backbone, as demonstrated by the fluorescence of a substituted polythiophene solution under UV irradiation. Polythiophenes (PTs) are polymerized thiophenes, a sulfur heterocycle. They are white solids with the formula (C4H2S)n for the parent PT.Strictly speaking, "polythiophene" is a misnomer, since the polymer consists of thienylene (2,5-C4H2S) repeat units.

PEDOT also has been proposed for dynamic applications where a potential is applied to a polymer film. PEDOT-coated windows and mirrors become opaque or reflective upon the application of an electric potential, a manifestation of its electrochromic properties. Widespread adoption of electrochromic windows promise significant savings in air conditioning costs. Another potential application include field-effect transistors,Garnier, F. "Field-Effect Transistors Based on Conjugated Materials".

The presence of choluria is a useful symptom to distinguish if somebody presenting with jaundice has liver disease (direct hyperbilirubinemia) or hemolysis (indirect hyperbilirubinemia). In the first case, patients have choluria due to excess conjugated ("direct") bilirubin in blood, which is eliminated by kidneys. Hemolysis, on the contrary, is characterized by unconjugated ("indirect") bilirubin which is bound to albumin and thus not eliminated in urine.

In developing children, hyperbilirubinemia may cause a yellow or green discoloration of teeth due to bilirubin deposition during the process of tooth calcification. While this may occur in children with hyperbilirubinemia, tooth discoloration due to hyperbilirubinemia is not observed in individuals with adult-onset liver disease. Disorders associated with a rise in serum levels of conjugated bilirubin during early development can also cause dental hypoplasia.

However, many of the systemic/toxic effects of nystatin in humans are attributable to its binding to mammalian sterols, namely cholesterol. This is the effect that accounts for the nephrotoxicity observed when high serum levels of nystatin are achieved. Nystatin also impacts cell membrane potential and transport by lipid peroxidation. Conjugated double bonds in nystatin's structure steal electron density from ergosterol in fungal cell membranes.

In only the twelve pages of the story, twelve infinitives appear without the final letter e: guardar, trattar, vincer, tentennar, abbandonar, spiccicar, correr, star (three times), frenar and accampar. In addition, conjugated verb forms can have their final letter dropped. In this example, parevan(o) and c'eran(o). There's a noun odor(e) and there are two adverbs as well, ancor(a) and fin(o).

Guanine (; or G, Gua) is one of the four main nucleobases found in the nucleic acids DNA and RNA, the others being adenine, cytosine, and thymine (uracil in RNA). In DNA, guanine is paired with cytosine. The guanine nucleoside is called guanosine. With the formula C5H5N5O, guanine is a derivative of purine, consisting of a fused pyrimidine-imidazole ring system with conjugated double bonds.

Like many Austronesian languages, the verbs of the Philippine languages follow a complex system of affixes to express subtle changes in meaning. However, the verbs in this family of languages are conjugated to express the aspects and not the tenses. Though many of the Philippine languages do not have a fully codified grammar, most of them follow the verb aspects that are demonstrated by Filipino or Tagalog.

I put my hand upon the Gospel or ...in the fire, i.e. I swear it's true, I'm sure of it). By contrast, Katharevousa continued to employ the ancestral form, , in place of . The verb system inherited from Ancient Greek gradually evolved, with the old future, perfect and pluperfect tenses gradually disappearing; they were replaced with conjugated forms of the verb (I have) to denote these tenses instead.

It is a bioactive sphingoid which derives from the sphinganine. It is formed by a sphingoid and an amino alcohol and it constitutes the conjugated base of 1-deoxymethylsphinganine (1+). His role is accepting a hydron from a donor via his organic amino compound; it is a Bronsted base. It is also known as deoxymethyl-SA, (2R)-1-aminoheptadecan-2-ol and 1-desoxymethylsphinganine.

Carnitine interacts with pivalate-conjugated antibiotics such as pivampicillin. Chronic administration of these antibiotics increases the excretion of pivaloyl-carnitine, which can lead to carnitine depletion. Treatment with the anticonvulsants valproic acid, phenobarbital, phenytoin, or carbamazepine significantly reduces blood levels of carnitine. When taken in the amount of roughly per day, carnitine may cause nausea, vomiting, abdominal cramps, diarrhea, and body odor smelling like fish.

A 'sandwich' is formed of solid-phase antibody, suPAR and peroxidase-conjugated antibody. The concentration (ng/mL plasma) of suPAR in the patient sample is determined via interpolation, based on a calibration curve prepared from seven suPAR standards. Recombinant suPAR standards are calibrated against healthy human blood donor samples. Absorbance is measured using a microtiter plate reader, at 450 nm with a 650 nm reference filter.

Resin acid is the general name for all kinds of acids that share the same basic skeleton, a three-fused ring and the empirical formula C20H30O2. The resin acids may be classified into two types, abietic and pimaric. The abietic-type group include levopimaric, l-abietic and neoabietic. The structure of these compounds differ only in the position of the conjugated double bond system.

This second antibody specifically binds with the bound antigens, thereby causing each bound antigen to be sandwiched between the first and eosin-conjugated antibodies. (Figure 1b) After ten minutes, the droplet on the surface is rinsed away in order to make sure that only the sandwiched binding complexes are left on the surface before adding the third solution. Lastly, a droplet of mixture of monomers (e.g.

A type of compound that is fairly common in the Indo-European languages is formed of a verb and its object, and in effect transforms a simple verbal clause into a noun. In Spanish, for example, such compounds consist of a verb conjugated for the second person singular imperative followed by a noun (singular or plural): e.g., rascacielos (modelled on "skyscraper", lit. 'scratch skies'), sacacorchos 'corkscrew' (lit.

A chromoprotein is a conjugated protein that contains a pigmented prosthetic group (or cofactor). A common example is haemoglobin, which contains a heme cofactor, which is the iron-containing molecule that makes oxygenated blood appear red. Other examples of chromoproteins include other hemochromes, cytochromes, phytochromes and flavoproteins. In hemoglobin there exists a chromoprotein (tetramer MW:4 x 16.125 =64.500), namely heme, consisting of Fe++ four pyrrol rings.

About a decade later, Jurkauskas and Buchwald also utilized dynamic kinetic resolution towards the hydrogenation of conjugated systems.Jurkauskas, V.; Buchwald, S. L. J. Am. Chem. Soc. 2002, 124, 2892–2893. 1,4 addition to cyclic enones is quite common in many reaction schemes, however asymmetric reductions in the presence of an easily epimerizable center adds to the complexity when trying to modify only one center.

Chlorin photosensitiser tin etiopurpurin is marketed as Purlytin. Purlytin has undergone Phase II clinical trials for cutaneous metastatic breast cancer and Kaposi's sarcoma in patients with AIDS (acquired immunodeficiency syndrome). Purlytin has been used successfully to treat the non-malignant conditions psoriasis and restenosis. Chlorins are distinguished from the parent porphyrins by a reduced exocyclic double bond, decreasing the symmetry of the conjugated macrocycle.

For decades Chamizer inspired Israelis to connect en-masse with opportunities for informal study via riddles, puzzles, games, nationwide treasure hunts and innovative educational projects. His surname – Chamizer – has become synonymous among Israelis with any riddle or intellectual challenge that requires wit, imagination and creativity to solve, and it has entered Hebrew slang as a verb, often conjugated playfully to describe the solving of sophisticated riddles.

Primary immunization against meningococcal disease with meningitis A, C, Y and W-135 vaccines is recommended for all young adolescents at 11–12 years of age and all unvaccinated older adolescents at 15 years of age. Although conjugate vaccines are the preferred meningococcal vaccine in adolescents 11 years of age or older, polysaccharide vaccines are an acceptable alternative if the conjugated vaccine is unavailable.

Lipo-oxytocin-1 (LOT-1) is a synthetic peptide and derivative of oxytocin that acts as an agonist of the oxytocin receptor. The lipidation strategy was applied to oxytocin to create a new peptide with improved pharmacokinetics. LOT-1 consists of oxytocin conjugated with two palmitoyl groups. After adjusting for molecular weight (LOT-1 is ~1.5x the weight of oxytocin), oxytocin and LOT-1 are equipotent.

Another use of bisulfite in organic chemistry is as a mild reducing agent, e.g. to remove traces or excess amounts of chlorine, bromine, iodine, hypochlorite salts, osmate esters, chromium trioxide and potassium permanganate. Sodium bisulfite is a decoloration agent in purification procedures because it reduces strongly coloured oxidizing agents, conjugated alkenes and carbonyl compounds. Bisulfite is also the key ingredient in the Bucherer reaction.

Visualization of the retinal bound active site of the 2L6X protein structure of pRhodopsin, residues color coded and labeled by activity, ligand is orange. The Rhodopsin haloprotein family shares the ligand Retinal, Vitamin A Aldehyde, one of the many types of Vitamin A. Retinal is a conjugated poly-unsaturated chromophore (polyene), obtained from carnivorous diet or by the carotene pathway (β-carotene 15,15'-monoxygenase).

Sumatriptan is metabolised primarily by monoamine oxidase A into 2‐{5‐[(methylsulfamoyl)methyl]‐indole‐3‐yl}acetic acid which is then conjugated to glucuronic acid. These metabolites are excreted in the urine and bile. Only about 3% of the active drug may be recovered unchanged. There is no simple, direct relationship between sumatriptan concentration (pharmacokinetics) per se in the blood and its anti-migraine effect (pharmacodynamics).

Representatives of the genus philodendron, from which the twins differ mainly in the conjugated, 1-3-chamber ovaries (in the case of the genus philodendron, ovaries are free and multi-chambered) and seeds without endosperms. In the non-blossoming state, Syngonium can be distinguished from philodendrons on non- cattalyllable leaves and clearly visible submarginal monofilament located 3–10 mm from the edge of the leaf.

Additionally, other conjugated polymers have been shown to have semiconducting properties. OFET design has also improved in the past few decades. Many OFETs are now designed based on the thin-film transistor (TFT) model, which allows the devices to use less conductive materials in their design. Improvement on these models in the past few years have been made to field-effect mobility and on–off current ratios.

LTA4 Note the four double bonds, three of them conjugated. This is a common property of A4, B4, C4, D4, and E4. LTB4 LTC4 is a cysteinyl leukotriene, as are D4 and E4. LTD4 LTE4 Leukotrienes are a family of eicosanoid inflammatory mediators produced in leukocytes by the oxidation of arachidonic acid (AA) and the essential fatty acid eicosapentaenoic acid (EPA) by the enzyme arachidonate 5-lipoxygenase.

The conjugated hyperbilirubinemia is a result of defective endogenous and exogenous transfer of anionic conjugates from hepatocytes into bile.Suzanne M Carter, MS Impaired biliary excretion of bilirubin glucuronides is due to a mutation in the canalicular multiple drug-resistance protein 2 (MRP2). A darkly pigmented liver is due to polymerized epinephrine metabolites, not bilirubin. Dubin–Johnson syndrome has an autosomal recessive pattern of inheritance.

Uyghur is an agglutinative language with a subject–object–verb word order. Nouns are inflected for number and case, but not gender and definiteness like in many other languages. There are two numbers: singular and plural and six different cases: nominative, accusative, dative, locative, ablative and genitive. Verbs are conjugated for tense: present and past; voice: causative and passive; aspect: continuous and mood: e.g. ability.

An Oromo verb root can be the basis for three derived voices, passive, causative, and autobenefactive, each formed with addition of a suffix to the root, yielding the stem that the inflectional suffixes are added to. ; Passive voice : The Oromo passive corresponds closely to the English passive in function. It is formed by adding -am to the verb root. The resulting stem is conjugated regularly.

An Endoglycosidase is an enzyme that releases oligosaccharides from glycoproteins or glycolipids. It may also cleave polysaccharide chains between residues that are not the terminal residue, although releasing oligosaccharides from conjugated protein and lipid molecules is more common. It breaks the glycosidic bonds between two sugar monomer in the polymer. It is different from exoglycosidase that it does not do so at the terminal residue.

The dipole-dipole and other intermolecular interactions align to minimize energy in the solid state and determine the crystal lattice structure. thumb A quadrupole, like a dipole, is a permanent pole but the electric field of the molecule is not linear as in acetone, but in two dimensions. Examples of molecular solids with quadrupoles are octafluoronaphthalene and naphthalene. Naphthalene consists of two joined conjugated rings.

UCNPs have also been used in functional imaging, such as the targeting of lymph nodes and the vascular system to assist in cancer surgeries. UCNPs enable multiplexed imaging by dopant modulation, shifting emission peaks to wavelengths that can be resolved. Single-band UCNPs conjugated to antibodies are used in detecting breast cancer cells, surpassing traditional fluorophore labeling of antibodies, which is not amenable to multiplexed analysis.

A gear bearing Gear bearing is roller bearing combining to epicyclical gear. Each element of it is represented by concentric alternation of rollers and gearwheels with equality of roller(s) diameter(s) to gearwheel(s) pitch diameter(s). The widths of conjugated rollers and gearwheels in pairs are the same. The engagement is herringbone or with the skew end faces to realize efficient rolling axial contact.

Only the conversion of linolenic acid to OPDA occurs in the chloroplast; all subsequent reactions occur in the peroxisome. JA itself can be further metabolized into active or inactive derivatives. Methyl JA (MeJA) is a volatile compound that is potentially responsible for interplant communication. JA conjugated with amino acid isoleucine (Ile) results in JA-Ile, which is currently the only known JA derivative needed for JA signaling.

Hungarian grammar is the grammar of Hungarian, a Finno-Ugric language that is spoken mainly in Hungary and in parts of its seven neighboring countries. Hungarian, a highly agglutinative language, uses various affixes, mainly suffixes, to change the meaning of words and their grammatical function. These affixes are mostly attached according to vowel harmony. Verbs are conjugated according to definiteness, tense, mood, person and number.

Kit for carrying out a test for antinuclear antibodies Stages of immunofluorescence for the detection of antinuclear antibodies. HEp-2 cells are permeablised (1) and then incubated with a person's blood serum (2). If the serum contains antibodies, they will bind to antigens within the HEp-2 cell nucleus. These antibodies can be visualised by subsequent incubation with anti-human antibodies conjugated to a fluorescent molecule (3).

Foods that are processed aseptically have better nutritional, vitamin, and natural pigment retention (chlorophyll, anthocyanins, betalains, carotenoids) compared to canned food products because of the lower temperature the foods are subjected to upon processing. Aseptic processing provides flexibility in using various container sizes as well as possibility of addition of bioactive and heat-sensitive components after processing (probiotics, omega-3 fatty acids, conjugated linoleic acids).

Spanish is a grammatically inflected language. Verbs are marked for tense, aspect, mood, person, and number (resulting in up to fifty conjugated forms per verb). Nouns follow a two-gender system and are marked for number. Personal pronouns are inflected for person, number, gender (including a residual neuter), and a very reduced case system; the Spanish pronominal system represents a simplification of the ancestral Latin system.

The mono- and di- hydroxylated metabolites of FICZ are subject to further metabolic changes to glucuronide- and sulfate-conjugates. Sulfotransferase (SULT) catalyzed reactions resulted in a more pronounced reduction of the hydroxylated FICZ metabolites than the glucuronidation. Further studies using human recombinant SULTs showed that SULT1A1, -1A2, -1B1 and -1E1 exhibited high catalytic efficiencies and 2-hydroxylated FICZ was more efficiently conjugated than the 8-hydroxylated FICZ.

The direct method is a one-step staining method and involves a labeled antibody (e.g. FITC-conjugated antiserum) reacting directly with the antigen in tissue sections. While this technique utilizes only one antibody and therefore is simple and rapid, the sensitivity is lower due to little signal amplification, in contrast to indirect approaches. However, this strategy is used less frequently than its multi-phase counterpart.

Equilenin, also known as 6,8-didehydroestrone, as well as estra-1,3,5(10),6,8-pentaen-3-ol-17-one, is a naturally occurring steroidal estrogen obtained from the urine of pregnant mares. It is used as one of the components in conjugated estrogens (brand name Premarin). It was the first complex natural product to be fully synthesized, in work reported by 1940 by Bachmann and Wilds.

Within 4–12 hours of the oral administration of a 10-mg dose to fasting adults, the attained mean ezetimibe peak plasma concentration (Cmax) was 3.4–5.5 ng/ml. Following oral administration, ezetimibe is absorbed and extensively conjugated to a phenolic glucuronide (active metabolite). Mean Cmax (45–71 ng/ml) of ezetimibe- glucuronide is attained within 1–2 hours. The concomitant administration of food (high-fat vs.

The functional form for dihedral energy is variable from one force field to another. Additional, "improper torsional" terms may be added to enforce the planarity of aromatic rings and other conjugated systems, and "cross-terms" that describe coupling of different internal variables, such as angles and bond lengths. Some force fields also include explicit terms for hydrogen bonds. The nonbonded terms are computationally most intensive.

Benzene, with the delocalization of the electrons indicated by the circle. In chemistry, delocalized electrons are electrons in a molecule, ion or solid metal that are not associated with a single atom or a covalent bond.IUPAC Gold Book delocalization The term delocalization is general and can have slightly different meanings in different fields. In organic chemistry, this refers to resonance in conjugated systems and aromatic compounds.

Classically, aromatic compounds were defined as planar molecules that possess a cyclically delocalized system of (4n+2)π electrons, satisfying Huckel's rule. Most importantly, these conjugated ring systems are known to exhibit enormous thermochemical stability relative to predictions based on localized resonance structures. Succinctly, three important features seem to characterize aromatic compounds: #molecular structure (i.e. coplanarity: all contributing atoms in the same plane) #molecular energetics (i.e.

Disharmony (misfit) in these conjugated parameters may arise due to a plethora of errors coming from bond angles or torsions from effectively the whole folded polypeptide chain. However, analogous to the Ramachandran Plot, the region within the first contour is termed 'probable' (analogous to the 'allowed' region), between the first and second contour, 'less probable' ('partially allowed') and outside the second contour 'improbable' ('disallowed').

The biomembrane is held tightly to the rubber core due to the high negative charge along the double bonds of the rubber polymer backbone. Free monomeric units and conjugated proteins make up the outer layer. The rubber precursor is isopentenyl pyrophosphate (an allylic compound), which elongates by Mg2+-dependent condensation by the action of rubber transferase. The monomer adds to the pyrophosphate end of the growing polymer.

After oral ingestion, pyrrolizidine alkaloids are absorbed from the gastrointestinal tract. When they reach the liver, they are metabolized via three pathways: N-oxidation, oxidation, and ester hydrolysis. N-oxidation and hydrolysis are detoxification pathways, and the products of these reactions are conjugated and excreted by the kidneys. However, the N-oxide may be converted back into the pyrrolizidine by cytochrome P-450 (CYP450) monooxygenases.

In Afrikaans verbs, the same form is generally used for both the infinitive and the present tense, with the exception of wees ("to be") conjugated as is and hê ("to have") conjugated as het, and there is no inflection for person; contrast ek gaan ("I go") with ik ga, hy doen ("he does") with hij doet, and julle was ("you (plural) were") with jullie waren. The past participle is usually regularly formed by adding the prefix ge- to the verb, hence gedoen ("done") is formed from doen in Afrikaans, although Dutch gedaan survives in Afrikaans as welgedaan! ("well done!") One exception is the verb hê ("to have") of which the past participle is gehad, while sometimes an irregular past participle is used with the verb dink ("to think") hence hy het gedag or hy het gedog, similar to Dutch hij heeft gedacht, instead of hy het gedink.

In this technique, one probe binds the reference which, in the case of HER-2/neu amplification detection, is CEN17 (the centromere of chromosome 17) while the other probe binds the target sequence which is HER-2/neu. DuoCISH combines both FISH and CISH in that it converts signals from FISH probes to chromogenic substrates. It works on the principle that blue cyanine dye is a substrate for HRP and red dye is a substrate for AP. For example, green fluorescein isothiocyanate (FITC) signals are converted to blue chromogenic precipitates through an anti- FITC antibody conjugated to HRP, and Texas Red signals are converted to red chromogenic precipitates through an anti-Texas Red antibody conjugated to AP. An advantage of DuoCISH is that it is possible to distinguish between chromosomal aneuploidy and gene amplification as the reference gene will also be amplified in aneuploidy but not in gene amplification detection.

McNeil is from Buffalo, New York. She graduated from the College of William and Mary in 1999 with a bachelors of science in Chemistry. Her graduate work was with Dave Collum at Cornell University, studying the aggregation kinetics and chemistry of lithium amides and lithium enolates. After earning her PhD in Chemistry in 2005, McNeil was a post-doc with Timothy M. Swager at MIT from 2005-2007, studying conjugated polymers.

Thus, the conjugated p-orbitals form a one-dimensional electronic band, and the electrons within this band become mobile when it is partially emptied. The band structures of conductive polymers can easily be calculated with a tight binding model. In principle, these same materials can be doped by reduction, which adds electrons to an otherwise unfilled band. In practice, most organic conductors are doped oxidatively to give p-type materials.

Despite the conjugated nature of the polyacetylene backbone, not all of the carbon–carbon bonds in the material are equal: a distinct single/double alternation exists. Each hydrogen atom can be replaced by a functional group. Substituted polyacetylenes tend to be more rigid than saturated polymers. Furthermore, placing different functional groups as substituents on the polymer backbone leads to a twisted conformation of the polymer chain to interrupt the conjugation.

This gene encodes a protein that is similar to other Ufm1-specific proteases. Studies in mouse determined that Ufsp1 releases Ufm1 (ubiquitin-fold modifier 1) from its bound conjugated complexes which also makes it into an active form. Because the human UFSP1 protein is shorter on the N-terminus and lacks a conserved Cys active site, it is predicted to be non-functional.[provided by RefSeq, Nov 2009].

Eaton, D. R.; Josey, A. D.; Phillips, W. D.; Benson, R. E. Hyperfine contact shifts and spin density distributions in some Ni(II) chelates. Discussions of the Faraday Society (1962), No. 34 77-87.Eaton, D. R.; Josey, A. D.; Phillips, W. D.; Benson, R. E. Spin-density distributions in conjugated ligands of paramagnetic chelates from nuclear magnetic resonance contact interaction shifts. Journal of Chemical Physics (1962), 37 347-60.

In immunohistochemistry the alkaline phosphatase is often used as a marker, conjugated to an antibody. The colored product can either be of the NBT/BCIP reaction reveals where the antibody is bound, or can be used in immunofluorescence. The NBT/BCIP reaction is also used for colorimetric/spectrophotometric activity assays of oxidoreductases. One application is in activity stains in gel electrophoresis, such as with the mitochondrial electron transport chain complexes.

Verbs show a triliteral Semitic pattern, in which a verb is conjugated with prefixes, suffixes, and infixes (for example ktibna, Arabic katabna, Hebrew kathabhnu (Modern Hebrew: katavnu) "we wrote"). There are two tenses: present and perfect. The Maltese verb system incorporates Romance verbs and adds Maltese suffixes and prefixes to them (for example, iddeċidejna "we decided" ← (i)ddeċieda "decide", a Romance verb + -ejna, a Maltese first person plural perfect marker).

Neddylation is the process by which the ubiquitin-like protein NEDD8 is conjugated to its target proteins. This process is analogous to ubiquitination, although it relies on its own E1 and E2 enzymes. No NEDD8-specific E3 has yet been identified and it is possible that the Neddylation system relies on E3 ligases with dual specificity.Herrmann J, Lerman LO, Lerman A. Ubiquitin and ubiquitin-like proteins in protein regulation.

The enzyme mainly responsible for metabolization of bromfenac is CYP2C9, and metabolites include the lactam and several conjugated compounds. 82% are excreted via the urine, and 13% via the faeces. The high degree of penetration and potency of bromfenac can be attributed to the halogenation of the molecule: by adding a bromine the NSAID becomes highly lipophilic which allows for rapid, sustained drug levels in the ocular tissues.

The design was part of a drive to create a standard fleet of locomotives using parts interchangeable with other Maunsell-designed classes. The three smaller cylinders increased their route availability over the 2-cylinder U class.Banks, pp. 66-67 The K1 rebuild featured a variant of the Gresley conjugated valve gear, previously trialled on the SR N1 class prototype, designed by one of Maunsell’s assistants, ex-GWR engineer Harold Holcroft.

In 1943, Wyeth purchased G. Washington Coffee Refining Company, an instant coffee company created by George Washington. In 1943, AHP merged with Ayerst, McKenna and Harrison, Ltd. of Canada. With this merger came Premarin, the world's first conjugated estrogen medicine, which was a flagship product for AHP until 2002, when preliminary results from the Women's Health Initiative linked it to a number of negative effects, including increased risk for breast cancer.

In acid–base chemistry, homoassociation (an IUPAC term) is an association between a base and its conjugate acid through a hydrogen bond. The alternate term homoconjugation also has wide usage, but is ambiguous because it has another meaning in organic chemistry (see Conjugated system#Mechanism). Most commonly, homoassociation leads to the enhancement of the acidity of an acid by itself. The effect is accentuated at high concentrations, i.e.

Spanish, like French, uses fully conjugated verbs followed by infinitives. For example, poder "to be able" (Puedo andar, "I can walk"), deber "to have an obligation" (Debo andar, "I must walk"), and querer "to want" (Quiero andar "I want to walk"). The correct use of andar in these examples would be reflexive. "Puedo andar" means "I can walk", "Puedo irme" means "I can go" or "I can take myself off/away".

A dependent clause may be finite (based on a finite verb, as independent clauses are), or non-finite (based on a verb in the form of an infinitive or participle). Particular types of dependent clause include relative clauses, content clauses and adverbial clauses. In certain instances, clauses use a verb conjugated in the subjunctive mood; see English subjunctive. Clauses can be nested within each other, sometimes up to several levels.

Kangaroo meat on sale in Melbourne Historically, the kangaroo has been a source of food for indigenous Australians. Kangaroo meat is high in protein and low in fat (about 2%). Kangaroo meat has a high concentration of conjugated linoleic acid (CLA) compared with other foods, and is a rich source of vitamins and minerals. Low fat diets rich in CLA have been studied for their potential in reducing obesity and atherosclerosis.

Latin declension is the set of patterns according to which Latin words are declined, or have their endings altered to show grammatical case, number and gender. Nouns, pronouns, and adjectives are declined (verbs are conjugated), and a given pattern is called a declension. There are five declensions, which are numbered and grouped by ending and grammatical gender. Each noun follows one of the five declensions, but some irregular nouns have exceptions.

Ptaquiloside has unstable chemical structure and readily undergoes glucose liberation. The resulting ptaquilodienone is the active form of ptaquiloside and accounts for the observed biological effects. The cyclopropyl group in the dienone is highly reactive as an electrophile, not only because it is conjugated with the keto group, but because it also constitutes a cyclopropyl carbinol system, from which the facile formation of the stable non-classical cation is well-known.

Pyrylium is a cation (positive ion) with formula , consisting of a six- membered ring of five carbon atoms, each with one hydrogen atom, and one positively charged oxygen atom. The bonds in the ring are conjugated as in benzene, giving it an aromatic character. In particular, because of the positive charge, the oxygen atom is trivalent. Pyrilium is a mono-cyclic and heterocyclic compound, one of the oxonium ions.

Such groups are known as chromophores and include aromatic groups, conjugated system of bonds, carbonyl groups and so on. Nuclear magnetic resonance spectroscopy detects hydrogen atoms in specific environments, and complements both IR and UV spectroscopy. The use of Raman spectroscopy is growing for more specialist applications. There are also derivative methods such as infrared microscopy, which allows very small areas to be analyzed in an optical microscope.

It increases the color of any organic compound. For example, benzene does not display color as it does not have a chromophore; but nitrobenzene is pale yellow color because of the presence of a nitro group (−NO2) which acts as a chromophore. But p-hydroxynitrobenzene exhibits a deep yellow color, in which the −OH group acts as an auxochrome. Here the auxochrome (−OH) is conjugated with the chromophore −NO2.

The solvent used can also assist in the stabilization of the negative charge on a conjugated base. Bases used to deprotonate depend on the pKa of the compound. When the compound is not particularly acidic, and, as such, the molecule does not give up its proton easily, a base stronger than the commonly known hydroxides is required. Hydrides are one of the many types of powerful deprotonating agents.

In many languages, verbs are conjugated according to number. Using French as an example, one says je vois (I see), but nous voyons (we see). The verb voir (to see) changes from vois in the first person singular to voyons in the plural. In everyday English, this often happens in the third person (she sees, they see), but not in other grammatical persons, except with the verb to be.

Four centuries after the fall of the Western Roman Empire, civilization had declined, arts and education were in a very poor state. There had been a momentary rebirth of culture and order in the time of Charlemagne, but soon with the return of invasions (especially the Vikings), western Europe was falling again. This conjugated with dramatic civil wars as explained above, as well as bad weather, plagues, and population loss.

Improperly prepared tissue samples may give false positives. In research, this reaction is used to stain cells that were prepared with hydrogen peroxidase enzyme, following common immunocytochemistry protocols. Relevant to Alzheimer's disease, Aβ protein amyloid plaques are targeted by a primary antibody, and subsequently by a secondary antibody, which is conjugated with a peroxidase enzyme. This will bind DAB as a substrate and oxidize it, producing an easily observable brown color.

Thompson also removed the Gresley conjugated valve gear and instead fitted independent sets of Walschaerts valve gear to each cylinder. The first locomotive to be rebuilt at Doncaster Works was No. 2005, Thane of Fife, which was ordered in October 1942 and completed in January 1943. After trials the remaining five P2 locomotives were ordered to be rebuilt in September 1943 and they all appeared in traffic during 1944.

Verbs are conjugated for aspect and mood, and given affixes for the person and number of both subjects and objects, as well as a host of other variables. The language's orthography, which was developed in the late 1930s after a series of prior attempts, is based on the Latin script. Most Navajo vocabulary is Athabaskan in origin, as the language has been conservative with loanwords since its early stages.

Granada medium was developed for selective isolation and identification of GBS from clinical specimens. Production of a red pigment (granadaene) on granada medium is unique to β-hemolytic group B streptococci isolated from humans. Granadaene is a non-isoprenoid polyenic pigment (ornithinrhamnododecaene) with a conjugated system of 12 double bonds. β-hemolysis and pigment production are encoded in GBS by a gene cluster of 12 genes, the cyl cluster.

Naproxen is a minor substrate of CYP1A2 and CYP2C9. It is extensively metabolized in the liver to 6-O-desmethylnaproxen, and both the parent drug and the desmethyl metabolite undergo further metabolism to their respective acylglucuronide conjugated metabolites. An analysis of two clinical trials shows that naproxen's time to peak plasma concentration occurs between 2–4 hours after oral administration, though naproxen sodium reaches peak plasma concentrations within 1–2 hours.

BN nanosheets consist of sp2-conjugated boron and nitrogen atoms that form a honeycomb structure. They contain two different edges: armchair and zig-zag. The armchair edge consists of either boron or nitrogen atoms, while the zig-zag edge consists of alternating boron and nitrogen atoms. These 2D structures can stack on top of each other and are held by Van der Waals forces to form few-layer boron nitride nanosheets.

The drug was approved in the European Union by the European Medicines Agency on April 27, 2009. On October 3, 2013 the FDA approved the combination product of bazedoxifene 20 mg with 0.45 mg Premarin (conjugated estrogens) for the treatment of menopausal osteoporosis and the treatment of moderate to severe hot flushes. This is the first approved menopausal hormone therapy product that contains a SERM (bazedoxifene) and an estrogen.

In Hebrew, verbs, which take the form of derived stems, are conjugated to reflect their tense and mood, as well as to agree with their subjects in gender, number, and person. Each verb has an inherent voice, though a verb in one voice typically has counterparts in other voices. This article deals mostly with Modern Hebrew, but to some extent, the information shown here applies to Biblical Hebrew as well.

Thompson drew up two modified 3-cylinder designs both of which discarded the Gresley conjugated valve gear and had separate sets of Walschaerts valve gear for each cylinder. Due to space restrictions, the middle cylinder could not be parallel with the outside cylinders. One design had the middle cylinder forward of the outside cylinders, whilst the chosen design had the middle cylinder further back. Both designs used A4 boilers.

Recent studies with 44Sc-DOTA-conjugated tumor targeting vectors such as octreotides, showed in vitro and in vivo stability and revealed pharmacological parameters adequate to long-term (up to one day) molecular imaging. Initial human studies with 44Sc-DOTATOC PET/CT imaging of somatostatin receptor positive liver metastases in a patient at early time-points (40 min p.i.) showed comparable results to 68Ga-DOTATATE(90 min. p.i.) in the same patient.

Hybrid solar cells combine advantages of both organic and inorganic semiconductors. Hybrid photovoltaics have organic materials that consist of conjugated polymers that absorb light as the donor and transport holes. Inorganic materials in hybrid cells are used as the acceptor and electron transporter in the structure. The hybrid photovoltaic devices have a potential for not only low-cost by roll-to-roll processing but also for scalable solar power conversion.

Pyrazole is an organic compound with the formula C3H3N2H. It is a heterocycle characterized by a 5-membered ring of three carbon atoms and two adjacent nitrogen atoms. Pyrazole is a weak base, with pKb 11.5 (pKa of the conjugated acid 2.49 at 25 °C).Dissociation constants of organic acids and bases Pyrazoles are also a class of compounds that have the ring C3N2 with adjacent nitrogen atoms.

The self-assembling peptides can be conjugated with polymers that are sensitive to pH and temperature. Through the synthesis of short peptides with various amino acid sequences the Miller group are studying the self-assembly of Beta sheets. She has developed a biocompatible, biodegradable cardiac patch, created from a thick porous scaffold coated with a material that mimics the extracellular matrix. She also studies the degradation mechanism of these materials.

It was taken by mouth. The main components of conjugated estriol are estriol glucuronides and to a lesser extent estriol sulfates. Estrogen glucuronides can be deglucuronidated into the corresponding free estrogens by β-glucuronidase in tissues that express this enzyme, such as the mammary gland, liver, and kidney, among others. Likewise, estrogen sulfates can be desulfated into the corresponding free estrogens by steroid sulfatase in tissues that express this enzyme.

Sometimes, just using an adverb is insufficient to express the exact meaning the speaker has in mind. The composition of a main verb (or adjective) and a supporting verb (or adjective) can be used in this case, alongside some grammatical features. Suffixes including -a/eo, -ge, -ji, and -go are taken by the main verb (or adjective), and the supporting verb (or a.) follows it and is conjugated.

Most grass-fed beef is leaner than feedlot beef, lacking marbling, which lowers the fat content and caloric value of the meat. Meat from grass-fed cattle has higher levels of conjugated linoleic acid (CLA) and the omega-3 fatty acids, ALA, EPA, and DHA. However, the absolute levels of CLA and the omega-3 acids remain extremely low. The beneficial effects of feeding omega-3 fatty acids remain uncertain.

Verbs in Literary Arabic are marked for person (first, second, or third), gender, and number. They are conjugated in two major paradigms (past and non-past); two voices (active and passive); and six moods (indicative, imperative, subjunctive, jussive, shorter energetic and longer energetic), the fifth and sixth moods, the energetics, exist only in Classical Arabic but not in MSA.Rydin, Karin C. (2005). A reference grammar of Modern Standard Arabic.

Triphenylamine is an organic compound with formula (C6H5)3N. In contrast to most amines, triphenylamine is nonbasic. Its derivatives have useful properties in electrical conductivity and electroluminescence, and they are used in OLEDs as hole-transporters.Wei Shi, Suqin Fan, Fei Huang, Wei Yang, Ransheng Liu and Yong Cao "Synthesis of Novel Triphenylamine-based Conjugated Polyelectrolytes and Their Application to Hole-Transport Layer in Polymeric Light-Emitting Diodes" J. Mater. Chem.

Verbs with these honorifics as subject are conjugated in the third person (e.g. "you are going" vs. "Your Honour is going" or "Her Royal Highness is going".) Protocol for monarchs and aristocrats can be very complex, with no general rule; great offence can be given by using a form that is not exactly correct. There are differences between "Your Highness" and "Your Royal Highness"; between "Princess Margaret" and "The Princess Margaret".

The disadvantages of the reaction involve side reactions of the carbene moiety. The choice of solvent for the reaction needs to be considered. In addition to the potential for carbon-hydrogen bond insertion reactions, carbon-halogen carbene insertion is possible when dichloromethane is used as the solvent. C-Cl bond insertion Control for regioselectivity during the carbene addition is necessary to avoid side products resulting from conjugated cycloheptatriene isomers.

According to "scanning hypothesis", the directional properties of REM sleep are related to a shift of gaze in dream imagery. Against this hypothesis is that such eye movements occur in those born blind and in fetuses in spite of lack of vision. Also, binocular REMs are non-conjugated (i.e., the two eyes do not point in the same direction at a time) and so lack a fixation point.

1,3-butadiene In organic chemistry a diene ( ) (diolefin ( ) or alkadiene) is a covalent compound that contains two double bonds, usually among carbon atoms. They thus contain two alkene units, with the standard prefix di of systematic nomenclature. As a subunit of more complex molecules, dienes occur in naturally occurring and synthetic chemicals and are used in organic synthesis. Conjugated dienes are widely used as monomers in the polymer industry.

In 1958 the photovoltaic effect or the creation of voltage of a cell based on magnesium phthalocyanine (MgPc)—a macrocyclic compound having an alternating nitrogen atom-carbon atom ring structure—was discovered to have a photovoltage of 200 mV. An Al/MgPc/Ag cell obtained photovoltaic efficiency of 0.01% under illumination at 690 nm. Conjugated polymers were also used in this type of photovoltaic cell. One device used polyacetylene (Fig.

However, these electron acceptor materials very weakly absorb visible light, decreasing the volume fraction occupied by the strongly absorbing electron donor material. Furthermore, fullerenes have poor electronic tunability, resulting in restrictions placed on the development of conjugated systems with more appealing electronic structures for higher voltages. Recent research has been done on trying to replace these fullerenes with organic molecules that can be electronically tuned and contribute to light absorption.

Its other active metabolites include the minor active metabolites temazepam and oxazepam. These metabolites are conjugated with glucuronide, and are excreted primarily in the urine. Because of these active metabolites, the serum values of diazepam alone are not useful in predicting the effects of the drug. Diazepam has a biphasic half-life of about one to three days, and two to seven days for the active metabolite desmethyldiazepam.

Prevnar vaccine Prevnar 13 (PCV13) is produced by Wyeth and replaced Prevnar. It is a tridecavalent vaccine, it contains thirteen serotypes of pneumococcus (1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F) which are conjugated to diphtheria carrier protein. Prevnar 13 was approved for use in the European Union in December 2009. Text was copied from this source which is © European Medicines Agency.

Estrogens have been used to limit final height in adolescent girls with tall stature. They do this by inducing epiphyseal closure and suppressing growth hormone-induced hepatic production and by extension circulating levels of insulin-like growth factor-1 (IGF-1), a hormone that causes the body to grow and increase in size. Although ethinylestradiol and conjugated estrogens have mainly been used for this purpose, estradiol can also be employed.

However, the overall findings indicate that quantum dots could be a valuable tool to investigate dynamic cellular processes. The abstract from the related published research paper states (in part): Results are presented regarding the dynamic fluorescence properties of bioconjugated nanocrystals or quantum dots (QDs) in different chemical and physical environments. A variety of QD samples was prepared and compared: isolated individual QDs, QD aggregates, and QDs conjugated to other nanoscale materials...

When warmed with mineral acid, limonene isomerizes to the conjugated diene α-terpinene (which can also easily be converted to p-cymene). Evidence for this isomerization includes the formation of Diels–Alder adducts between α-terpinene adducts and maleic anhydride. It is possible to effect reaction at one of the double bonds selectively. Anhydrous hydrogen chloride reacts preferentially at the disubstituted alkene, whereas epoxidation with mCPBA occurs at the trisubstituted alkene.

Other types of solid-state organic lasers include the organic semiconductor lasers that use conjugated polymers as gain media.C. Karnutsch, Low Threshold Organic Thin Film Laser Devices (Cuvillier, Göttingen, 2007). These semiconductor materials can also be configured as "neat films." Coherent emission, characterized via high-visibility double-slit interferograms (V ~ 0.9) and near diffraction-limited beam divergence, has been reported from electrically-pumped coumarin dye-doped tandem OLED devices.

In contrast, clauses with an unmarked verb form do not have a dominant word order; three of the six possible orders (subject-verb-object, verb-subject-object and object- verb-subject) occur with roughly-equal frequency. Verbs, like those of other western Indonesian languages, are not conjugated for tense, mood or aspect. All affixes are derivational. Verbs may appear in two forms: unmarked (also known as basic or oral) and nasal.

Another example of its use is in the synthesis of leukotriene A methyl ester. The first step uses a stabilised ylide, where the carbonyl group is conjugated with the ylide preventing self condensation, although unexpectedly this gives mainly the cis product. The second Wittig reaction uses a non-stabilised Wittig reagent, and as expected this gives mainly the cis product. Note that the epoxide and ester functional groups survive intact.

Benzene is one of the best-known aromatic compounds as it is one of the simplest and most stable aromatics. Aromatic hydrocarbons contain conjugated double bonds. This means that every carbon atom in the ring is sp2 hybridized, allowing for added stability. The most important example is benzene, the structure of which was formulated by Kekulé who first proposed the delocalization or resonance principle for explaining its structure.

The use of this construction is particularly common with compound subjects, as in, e.g., Eu e ela, nós fomos passear ("She and I, we went for a walk"). This happens because the traditional syntax (Eu e ela fomos passear) places a plural-conjugated verb immediately following an argument in the singular, which may sound unnatural to Brazilian ears. The redundant pronoun thus clarifies the verbal inflection in such cases.

CellSearch is the only FDA-approved platform for CTC isolation. This method is based on the use of iron nanoparticles coated with a polymer layer carrying biotin analogues and conjugated with antibodies against EpCAM for the capture of CTCs. Isolation is coupled to an analyzer to take images of isolated cells upon their staining with specific fluorescent antibody conjugates. Blood is sampled in an EDTA tube with an added preservative.

Thermochemical scanning probe lithography (tc-SPL) or thermochemical nanolithography (TCNL) employs the scanning probe tips to induce thermally activated chemical reactions to change the chemical functionality or the phase of surfaces. Such thermally activated reactions have been shown in proteins, organic semiconductors, electroluminescent conjugated polymers, and nanoribbon resistors. Furthermore, deprotection of functional groups (sometimes involving a temperature gradients), reduction of oxides, and the crystallization of piezoelectric/ferroelectric ceramics has been demonstrated.

Sardinian, due to its early breaking off from Proto-Romance, displays different traits in its morphology. Notably, in the future tense, the verb habeo (aere in Sardinian) is instead proclitic, and does not have an individual conjugation on the verb. Instead, aere is conjugated into present tense, and the other verb's infinitive form is used. Thusly, app'aere, app'appidu and app'aere appidu are aere's future, perfect, and future perfect.

The basic structure of the hydrophobic retinoid molecule consists of a cyclic end group, a polyene side chain and a polar end group. The conjugated system formed by alternating C=C double bonds in the polyene side chain are responsible for the color of retinoids (typically yellow, orange, or red). Hence, many retinoids are chromophores. Alternation of side chains and end groups creates the various classes of retinoids.

Bempegaldesleukin is a recombinant form of human cytokine interleukin-2 conjugated to six releasable polyethylene glycol chains. PEGylation of IL-2 is utilized to alter its receptor binding. PEG chains are located at the region of IL-2 that binds to the IL2Rα subunit of the heterotrimeric IL2Rαβγ complex, reducing its ability to bind and activate the heterotrimer. The IL2Rαβγ complex is constitutively expressed on regulatory T cells (Tregs).

In each lesson (drop-down menus) students have to learn words in order, and can click to repeat when needed. The software can listen and score pronunciation, and students can record their voice, and compare it to the lesson. Some languages have grammar lessons as well as vocabulary. The "Main course" has "Core Vocabulary" with 100 categories from beginner to intermediate, Powerful Phrases with 50 travel categories, and 100 verbs conjugated.

OECTs consist of a semiconductor film (the channel), usually made of a conjugated polymer, which is in direct contact with an electrolyte. Source and drain electrodes establish electrical contact to the channel, while a gate electrode establishes electrical contact to the electrolyte. The electrolyte can be liquid, gel, or solid. In the most common biasing configuration, the source is grounded and a voltage (drain voltage) is applied to the drain.

Solid black lines represent covalent bond formation Synthetic scheme of covalent organic framework using boronic acid and hexahydroxytriphenylene. Many covalent organic frameworks derive their topology from the directionality of the covalent linkages, thus small changes in organic linkers can dramatically affect their mechanical and electronic properties. Even small changes in their structure can induce dramatic changes in stacking behavior of molecular semiconductors. Porphyrins are an additional class of conjugated, heterocyclic macrocycles.

D49/1 (Part 1) locomotives were built with piston valves, activated by Walschaerts valve gear for the outside cylinders, and Gresley conjugated valve gear for the inside cylinder. D49/3 (Part 3) locomotives were built with Lentz oscillating poppet valves activated by Walschaerts valve gear. All were later rebuilt to D49/1 valve gear arrangements. D49/2 (Part 2) locomotives were built with Lentz poppet valves activated by rotary cams.

Another implementation to enhance the biodegradable architecture of the CPs is by use of monomers and conjugated links that are degradable. The biodegradable polymers used in biomedical applications typically consist of hydrolyzable esters and hydrazones. These molecules, upon external stimulation, go on to be cleaved and broken down. The cleaving activation process can be achieved through use of an acidic environment, increasing the temperature, or by use of enzymes.

Onnamide A is a complex biomolecule with a 39 unique carbon atoms and 11 degrees of unsaturation. Its core contains three rings, two of which comprise a dimeric lactone structure. It contains a long side chain that has a three conjugated trans- olefins that connects to an amide bond, terminating in an arginine residue. The stereochemical assignments of onnamide A have been extensively characterized by experimental and advanced NMR studies.

The product of this gene participates in physiological processes involving bile acids, conjugated steroids, and cyclic nucleotides. In addition, a single nucleotide polymorphism (SNP) in this gene is responsible for determination of human earwax type and presence of underarm odour. This gene and family member ABCC12 are determined to be derived by duplication and are both localized to chromosome 16q12.1. Multiple alternatively spliced transcript variants have been described for this gene.

"was doing" or "were doing"). These are combinations of past tense with specifically continuous or progressive aspect. In German, Imperfekt formerly referred to the simply conjugated past tense (to contrast with the Perfekt or compound past form), but the term Präteritum (preterite) is now preferred, since the form does not carry any implication of imperfective aspect. "Imperfect" comes from the Latin "unfinished", because the imperfect expresses an ongoing, uncompleted action.

The product of the reaction is further phosphorylated to tri-phosphate and incorporated in DNA-strings of polythymidine. The polythymidine binds to strings of polyadenine coupled to the bottom of the wells in microtiter plates. There it is detected with an ELISA technique: The wells are filled with a solution of a monoclonal antibody to bromo-deoxyuridine. The monoclonal antibody has been bound (conjugated) to the enzyme alkaline phosphatase.

G&T; sequencing separates the mRNA from the gDNA using an unbiased global amplification procedure described previously. First, mRNA is isolated on specialized oligo-dT (5’-biotin-triethyleneglycol- AAGCAGTGGTATCAACGCAGAGTAC(T)30VN-3’) conjugated to streptavidin-coupled paramagnetic beads. The oligo-dT binds to the poly-A tails of processed mRNA, fishing them out from the pool of genomic material. Next, the paramagnetic beads are spatially isolated by magnetization.

The ELP can be conjugated to a functional group that can bind to a protein of interest. At temperatures below the Tt, the ELP will bind to the ligand in its linear form. In this linear state, the ELP-protein complex cannot easily be distinguished from the extraneous proteins in the solution. However, once the solution is heated to a temperature exceeding the Tt, the ELP will form spherical clumps.

There are various biotechnological advances for in vivo delivery of drugs. To effectively target the malignant cells, the AuNPs were conjugated by polyethylene glycol, a process known as PEGylation. This masks the foreign particles from the immune system such that it arrives at its destination and increases circulation time in the system. Antibody conjugation lines the surface of the nanoparticle with cell markers to limit spread only to malignant cells.

Researchers conjugated the thermo-responsive polymer poly(N-isopropylacrylamide) (pNIPAm) with the biotin-recognizing protein streptavidin close to its recognition site. At temperatures above the lower critical solution temperature (LCST), the polymer collapses and blocks the binding site, thus reversibly preventing biotin from binding to streptavidin. By copolymerization with two different thermosensitive polymers poly(sulfobetaine methacrylamide) (pSBAm) and pNIPAm together, researchers can control enzyme activity in a small temperature window.

Her main research areas are the microfabrication and selective patterning of organic electronic materials and inorganic-organic frameworks. She developed a model that describes the relationship between charge transport, disorder and aggregation in conjugated molecular systems. High molecular weight polymers demonstrate a charge transport that is limited by lattice disorder. She also demonstrated that crystallisation of fullerene molecules in polymer/fullerene blends is the driver of charge separation.

Metabolites of progesterone with one or more available hydroxyl groups are conjugated via glucuronidation and/or sulfation and excreted. The biological half-life of progesterone in the circulation is very short; with intravenous injection, its half-life has ranged widely from 3 to 90 minutes in various studies. The metabolic clearance rate of progesterone ranges between 2,100 and 2,800 L/day, and is constant across the menstrual cycle.

Danheiser's research has focused on the development of new strategies for the synthesis of complex molecules and their application in the total synthesis of natural products. Synthetic methods invented in his laboratory include highly stereoselective [4 + 1] cyclopentene annulations based on oxyanion and carbanion-accelerated vinylcyclopropane rearrangements; the application of organosilanes (e.g., allenylsilanes, propargylsilanes, and allylsilanes) in a general [3 + 2] annulation strategy for the synthesis of five-membered carbocycles and heterocycles (the "Danheiser Annulation"); benzannulation strategies based on pericyclic transformations of vinylketenes (“Danheiser Benzannulation”); methods for the synthesis of aromatic and dihydroaromatic compounds based on cycloadditions of highly unsaturated conjugated molecules such as conjugated 1,3-enynes; and formal [2 + 2 + 2] cycloadditions based on propargylic ene reaction/Diels-Alder cycloaddition cascades. Natural products synthesized in his laboratory at MIT include the neurotoxic alkaloids anatoxin a and quinolizidine 217A, the immunosuppressant agent mycophenolic acid the antitumor agent ascochlorin and a number of diterpene quinones derived from the Chinese traditional medicine Dan Shen.

Camidanlumab tesirine (Cami-T or ADCT-301) is an antibody-drug conjugate (ADC) composed of a human antibody that binds to the protein CD25, conjugated to a pyrrolobenzodiazepine dimer toxin. The experimental drug, developed by ADC Therapeutics is being tested in clinical trials for the treatment of B-cell Hodgkin's lymphoma (HL) and non-Hodgkin lymphoma (NHL), and for the treatment of B-cell acute lymphoblastic leukemia (ALL) and acute myeloid leukemia (AML).

Changes in both color and conductivity are induced by the same mechanism, twisting of the polymer backbone and disrupting conjugation, making conjugated polymers attractive as sensors that can provide a range of optical and electronic responses. The development of polythiophenes and related conductive organic polymers was recognized by the awarding of the 2000 Nobel Prize in Chemistry to Alan J. Heeger, Alan MacDiarmid, and Hideki Shirakawa "for the discovery and development of conductive polymers".

Cyclooctadecanonaene or [18]annulene is an organic compound with chemical formula . It belongs to the class of highly conjugated compounds known as annulenes and is aromatic. The usual isomer that [18]annulene refers to is the most stable one, containing six interior hydrogens and twelve exterior ones, with the nine formal double bonds in the cis,trans,trans,cis,trans,trans,cis,trans,trans configuration. It is reported to be a red-brown crystalline solid.

High conjugated bilirubin may be due to liver diseases such as cirrhosis or hepatitis, infections, medications, or blockage of the bile duct. Blockage of the bile duct may occur due to gallstones, cancer, or pancreatitis. Other conditions can also cause yellowish skin, but are not jaundice, including carotenemia — which can develop from eating large amounts of foods containing carotene — or medications such as rifampin. Treatment of jaundice is typically determined by the underlying cause.

In cellular biology, the isothiocyanate derivative of fluorescein is often used to label and track cells in fluorescence microscopy applications (for example, flow cytometry). Additional biologically active molecules (such as antibodies) may also be attached to fluorescein, allowing biologists to target the fluorophore to specific proteins or structures within cells. This application is common in yeast display. Fluorescein can also be conjugated to nucleoside triphosphates and incorporated into a probe enzymatically for in situ hybridisation.

In organic chemistry, the Diels–Alder reaction is a chemical reaction between a conjugated diene and a substituted alkene, commonly termed the dienophile (also spelled dieneophile), to form a substituted cyclohexene derivative. It is the prototypical example of a pericyclic reaction with a concerted mechanism. More specifically, it is classified as a thermally-allowed [4+2] cycloaddition with Woodward–Hoffmann symbol [π4s \+ π2s]. It was first described by Otto Diels and Kurt Alder in 1928.

Many other food ingredients are used as thickeners, usually in the final stages of preparation of specific foods. These thickeners have a flavor and are not markedly stable, thus are not suitable for general use. However, they are very convenient and effective, and hence are widely used. Functional flours are produced from specific cereal variety (wheat, maize, rice or other) conjugated to specific heat treatment able to increase stability, consistency and general functionalities.

In a normal demand Diels–Alder reaction, the dienophile has an electron-withdrawing group in conjugation with the alkene; in an inverse-demand scenario, the dienophile is conjugated with an electron-donating group. Dienophiles can be chosen to contain a "masked functionality". The dienophile undergoes Diels–Alder reaction with a diene introducing such a functionality onto the product molecule. A series of reactions then follow to transform the functionality into a desirable group.

The following verbs are very irregular, and may not fit neatly into the strong-weak split. An important subset of these verbs are the preterite-present verbs, which are shared by all Germanic languages. In the present tense, they originally conjugated like the past tense of a strong verb. In Dutch, this means that they lack the -t in the third-person singular present indicative, much like their English equivalents which lack the -s.

8,9-Dehydroestradiol, or Δ8-17β-estradiol, also known as estra-1,3,5(10),8-tetraen-17β-ol-3-one, is a naturally occurring steroidal estrogen found in horses which is closely related to equilin, equilenin, and estradiol, and, as the 3-sulfate ester sodium salt, is a minor constituent of conjugated estrogens (Premarin). It is also an important active metabolite of 8,9-dehydroestrone, analogously to conversion of estrone or estrone sulfate into estradiol.

Methyltestosterone is typically used as an oral medication. It is also available under the brand names Metandren and Oreton Methyl for use specifically by buccal or sublingual administration. Methyltestosterone is available in the form of 2, 5, 10, and 25 mg oral tablets. It was also available in combination with estrogens as esterified estrogens/methyltestosterone (0.625 mg/1.25 mg, 1.25 mg/2.5 mg) and conjugated estrogens/methyltestosterone (0.625 mg/5.0 mg, 1.25 mg/10 mg).

The heme group is a highly conjugated ring system (which allows its electrons to be very mobile) surrounding an iron ion. The iron in cytochromes usually exists in a ferrous (Fe2+) and a ferric (Fe3+) state with a ferroxo (Fe4+) state found in catalytic intermediates. Cytochromes are, thus, capable of performing electron transfer reactions and catalysis by reduction or oxidation of their heme iron. The cellular location of cytochromes depends on their function.

Germanic languages tend to have two morphologically distinct simple forms, for past and non-past, as well as a compound construction for the past or for the perfect, and they use modal auxiliary verbs. The simple forms, the first part of the non-modal compound form, and possibly the modal auxiliaries, are usually conjugated for person and/or number. A subjunctive mood form is sometimes present. English also has a compound construction for continuous aspect.

Vinylogy is the transmission of electronic effects through a conjugated organic bonding system.The Vinylogous Aldol Reaction: A Valuable, Yet Understated Carbon-Carbon Bond-Forming Maneuver Giovanni Casiraghi, Franca Zanardi, Giovanni Appendino, and Gloria Rassu Chem. Rev. 2000; 100(6) pp 1929 - 1972; (Review) The concept was introduced in 1926 by Ludwig Claisen to explain the acidic properties of formylacetone and related ketoaldehydes.Zu den O-Alkylderivaten des Benzoyl-acetons und den aus ihnen entstehenden Isoxazolen.

The highly conjugated ligand framework of bis(imino)pyridine stabilizes metals in unusual oxidation states. The ability of the neutral complex to accept up to three electrons leads to ambiguity about the oxidation states of the metal center. The complex Fe(DIP)(N2)2 complex is ostensibly a 18e complex, consisting of Fe(0) with five 2-electron ligands. Mössbauer spectroscopy indicates, however, that this complex is better described as a ferrous derivative of DIP2−.

Loo et al. investigated gold nanoshells, coating silica nanoparticles with a thin layer of gold.Loo C, Lowery A, Halas N, West J, Drezek R, Immunotargeted nanoshells for integrated cancer imaging and therapy, Nano Letters, 2005, 5 (4), 709-711 The authors conjugated antibodies (anti-HER2 or anti-IgG) to these nanoshells via PEG linkers. After incubation of SKBr3 cancer cells with the gold nanoshells, an 820 nm laser was used to irradiate the cells.

The contorted PAHs owing to their non-polar and non-planar topology and shape are expected to offer a balance between miscibility and self- aggregation for optimal charge transport to electrodes. These contorted conjugated aromatic molecules support the charge transport due to resonance of electrons and hinder the possibility of electron hole pair recombination for having suitable HOMO and LUMO offsets at donor and acceptor interphase while allowing the antagonistic charge percolation pathways.

Hydroxylation is the major and primary biotransformation of tebufenpyrad reported both in vivo and in vitro. Ethyl and tetra-butyl groups are the targets of hydroxylation. The alcohol groups are oxidized to carboxylic groups which can then be conjugated with other groups in vivo. In rodent studies it was shown that 80% of the pesticide was absorbed mainly in the digestive system within 24 hours, the major metabolites being the hydroxylated forms.

Superparamagnetic iron–platinum particles (SIPPs) have been reported and had significantly better T2 relaxivities compared with the more common iron oxide nanoparticles. SIPPs were also encapsulated with phospholipids to create multifunctional SIPP stealth immunomicelles that specifically targeted human prostate cancer cells. These are, however, investigational agents which have not yet been tried in humans. In a recent study, multifunctional SIPP micelles were synthesized and conjugated to a monoclonal antibody against prostate-specific membrane antigen.

Figure 1. Schematic description of Photopolymerization-based signal amplification PBA is achieved by sequentially adding three kinds of solutions to a test strip and illuminating it with green light. First, a droplet of a patient’s sample is loaded on a test strip whose surface is covered with immobilized antibodies. If the sample contains the target antigens, they bind to the immobilized antibodies. (Figure 1a) Second, eosin-conjugated antibodies are added to the patient’s sample.

For example, fluorophores conjugated to cholera-toxin B-subunit, which binds to the raft constituent ganglioside GM1 is used extensively. Also used are lipophilic membrane dyes which either partition between rafts and the bulk membrane, or change their fluorescent properties in response to membrane phase. Laurdan is one of the prime examples of such a dye. Rafts may also be labeled by genetic expression of fluorescent fusion proteins such as Lck-GFP.

PCP is quickly absorbed through the gastrointestinal tract following ingestion. Accumulation is not common, but if it does occur, the major sites are the liver, kidneys, plasma protein, spleen, and fat. Unless kidney and liver functions are impaired, PCP is quickly eliminated from tissues and blood, and is excreted, mainly unchanged or in conjugated form, via the urine. Single doses of PCP have half- lives in blood of 30 to 50 hours in humans.

Verbs in Old Swedish were conjugated according to person and number. There were four weak verb conjugations and six groups of strong verbs. The difference between weak and strong verbs is in the way the past tense (preterite) is formed: strong verbs form it with a vowel shift in the root of the verb, while weak verbs form it with a dental suffix (þ, d or t).Germanic languages: conjugate Old Swedish verbs. Verbix.com.

1,3-Butadiene is an organic compound that is a simple conjugated diene hydrocarbon (dienes have two carbon-carbon double bonds). Polybutadiene forms by linking many 1,3-butadiene monomers to make a much longer polymer chain molecule. In terms of the connectivity of the polymer chain, butadiene can polymerize in three different ways, called cis, trans and vinyl. The cis and trans forms arise by connecting the butadiene molecules end-to-end, so-called 1,4-polymerisation.

Carvedilol is about 25% to 35% bioavailable following oral administration due to extensive first-pass metabolism. The compound is metabolized by liver enzymes, CYP2D6 and CYP2C9 via aromatic ring oxidation and glucuronidation, then further conjugated by glucuronidation and sulfation. The three active metabolites exhibit only one tenth of the vasodilating effect of the parent compound. However, the 4’hydroxyphenyl metabolite is about 13-fold more potent in β-blockade than the parent.

McCullough's research at Carnegie Mellon University focused on the self-assembly and synthesis of highly conductive organic polymers and oligimers, conjugated polymer sensors, nanoelectronic assembly and fabrication of molecular circuits and transistors, printable metals, new design methods and the synthesis of organic-inorganic hybrid nanomagnets and high-spin materials, crystal engineering and novel nanocrystalline semiconductor materials. In 1991, the McCullough group reported the first synthesis of regioregular head-to-tail coupled poly (3-alkylthiophenes).

When the peptide antigens are produced synthetically, a terminal cysteine residue is added at either the N- or C-terminus of the peptide. This cysteine residue contains a sulfhydryl functional group which allows the peptide to be easily conjugated to a carrier protein (e.g. Keyhole limpet hemocyanin (KLH)). The same cysteine-containing peptide is also immobilized onto an agarose resin through the cysteine residue and is then used to purify the antibody.

Flavoproteins were first mentioned in 1879, when they isolated as a bright-yellow pigment from cow's milk. They were initially termed lactochrome. By the early 1930s, this same pigment had been isolated from a range of sources, and recognised as a component of the vitamin B complex. Its structure was determined was reported in 1935 and given the name riboflavin, derived from the ribityl side chain and yellow colour of the conjugated ring system.

Diels-Alder reactions occur between a conjugated diene and an alkene (commonly known as the dienophile). This cycloaddition process allows for the stereoselective formation of cyclohexene rings capable of possessing as many as four contiguous stereogenic centers. Diels-Alder reactions can lead to formation of a variety of structural isomers and stereoisomers. The molecular orbital theory considers that endo transition state, instead of the exo transition state, is favored (endo addition rule).

This port is called the regular port. Its peer port, the conjugated port, receives the outgoing messages and sends the incoming ones of the protocol. In other words, a port is the combination of a required and a provided interface in a role (since one and the same protocol can be used by several ports of an actor). Example of a structure diagram An actor can contain other actors (as a composition).

CimaVax-EGF is a vaccine used to treat cancer, specifically non-small-cell lung carcinoma (NSCLC). CIMAvax-EGF is composed of recombinant human epidermal growth factor (EGF) conjugated to a protein carrier. The vaccine was developed by the Center of Molecular Immunology, Havana, Cuba There are agreements in place to test it in the United States, Japan, and some European countries. It is currently available in Cuba, Colombia, Bosnia and Herzegovina, Peru and Paraguay.

Eventually, and usually after 2 months, cirrhosis with portal hypertension will develop. If left untreated, biliary atresia can lead to liver failure. Unlike other forms of jaundice, however, biliary-atresia-related cholestasis mostly does not result in kernicterus, a form of brain damage resulting from liver dysfunction. This is because in biliary atresia, the liver, although diseased, is still able to conjugate bilirubin, and conjugated bilirubin is unable to cross the blood–brain barrier.

For the detection of HIV antibodies, the wells of microtiter plate are coated with the HIV antigen. Two specific antibodies are used, one conjugated with enzyme and the other present in serum (if serum is positive for the antibody). Cumulative competition occurs between the two antibodies for the same antigen, causing a stronger signal to be seen. Sera to be tested are added to these wells and incubated at 37 °C, and then washed.

Non-basic tendencies in organocerium reagents The oxophilicity of cerium imparts strong 1,2-selectivity in reactions with conjugated electrophiles similarly to organolithium reagents. At the same time, organocerium reagents can be used to synthesize ketones from acyl compounds without over-addition, as seen with organocuprates. This dichotomy illustrates the unique reactivity of organolanthanide reagents. Reactivity and selectivity of organocerium compounds Finally, organocerium reagents have been employed in a number of total syntheses.

Sanskrit verbs are conjugated in three persons (as in English): first, second, and third person. Verbs also have three numeric forms: singular, dual, and plural. Any verb that refers to only two objects must be in the dual form. Participles are considered part of the verbal systems although they are not verbs themselves, and as with other Sanskrit nouns, they can be declined across seven or eight cases, for three genders and three numeric forms.

Annulynes or dehydroannulenes are conjugated monocyclic hydrocarbons with alternating single and double bonds in addition to at least one triple bond. Annulynes They are related to annulenes, which only have alternating single and double bonds. The smallest member of this class is [4]annulyne but is never observed because the molecule carries too much angle strain. The next member is [6]annulyne or benzyne which is a reactive intermediate well known in organic chemistry.

The caption generally acts as a speech balloon encompassing a comment from the cat, or as a description of the depicted scene. The caption is intentionally written with deviations from standard English spelling and grammar, featuring "conjugated verbs, but a tendency to converge to a new set of rules in spelling and grammar". The text parodies the grammar-poor patois stereotypically attributed to Internet slang. Frequently, lolcat captions take the form of phrasal templates.

Finally, the gold- standard method of cellular localization is immunoelectron microscopy. This technique also uses an antibody to the protein of interest, along with classical electron microscopy techniques. The sample is prepared for normal electron microscopic examination, and then treated with an antibody to the protein of interest that is conjugated to an extremely electro-dense material, usually gold. This allows for the localization of both ultrastructural details as well as the protein of interest.

According to another theory, the word mus comes from the Latin "musso", that means "keep silent". It is conjugated as "mus" ("I keep silent"), in opposition to "talk", that is the word used to open the game. A third hypothesis is that the word may have come from the French "mouche" ("fly"), from Latin mussula,Larousse Dictionnaire d' Étymologie Larousse:2001 although the concept "fly" has no relevance to any part of the game.

CD74 is an attractive target for a drug conjugate because of its rapid internalizing property. In preclinical studies with human lymphomas and myelomas, both naked Milatuzumab and the Milatuzumab conjugated with doxorubicin,Anti-CD74 antibody-doxorubicin conjugate, IMMU-110, in a human multiple myeloma xenograft and in monkeys. P. Sapra, R. Stein, J. Pickett, Z. Qu, S.V. Govindan, T.M. Cardillo, H.J. Hansen, I.D. Horak, G.L. Griffiths, D.M. Goldenberg. Clin Cancer Res 11:5257-5264, 2005.

The pH of the unknown solution can then be estimated. Obvious disadvantages of this method include its dependency on the colour sensitivity of the human eye, and that unknown solutions that are already coloured cannot be used. The colour change of halochromic substances occur when the chemical binds to existing hydrogen and hydroxide ions in solution. Such bonds result in changes in the conjugated systems of the molecule, or the range of electron flow.

Cells are immersed in a medium where access to nutrients is limited to synthetically modified analogues of standard fuels such as sugars. As a consequence, these altered biomolecules are incorporated into the cells in the same manner as the unmodified metabolites. A probe is then incorporated into the system to image the fate of the altered biomolecules. Other methods of functionalization include enzymatically inserting azides into proteins, and synthesizing phospholipids conjugated to cyclooctynes.

To utilize FRET for phosphorylation studies, fluorescent proteins are coupled to both a phosphoamino acid binding domain and a peptide that can by phosphorylated. Upon phosphorylation or dephosphorylation of a substrate peptide, a conformational change occurs that results in a change in fluorescence. FRET has also been used in tandem with Fluorescence Lifetime Imaging Microscopy (FLIM) or fluorescently conjugated antibodies and flow cytometry to provide quantitative results with excellent temporal and spatial resolution.

Benzyl alcohol has low acute toxicity with an of 1.2 g/kg in rats. It oxidizes rapidly in healthy individuals to benzoic acid, conjugated with glycine in the liver, and excreted as hippuric acid. Very high concentrations can result in toxic effects including respiratory failure, vasodilation, hypotension, convulsions, and paralysis. Benzyl alcohol is toxic to neonates and is associated with the gasping syndrome... Benzyl alcohol is severely toxic and highly irritating to the eye.

Immunofluorescence image of the eukaryotic cytoskeleton. Microtubules as shown in green, are marked by an antibody conjugated to a green fluorescing molecule, FITC. Specific antibodies are produced by injecting an antigen into a mammal, such as a mouse, rat, rabbit, goat, sheep, or horse for large quantities of antibody. Blood isolated from these animals contains polyclonal antibodies—multiple antibodies that bind to the same antigen—in the serum, which can now be called antiserum.

Intravenous and oral formulations of acetylcysteine are available for the treatment of paracetamol (acetaminophen) overdose. When paracetamol is taken in large quantities, a minor metabolite called N-acetyl-p-benzoquinone imine (NAPQI) accumulates within the body. It is normally conjugated by glutathione, but when taken in excess, the body's glutathione reserves are not sufficient to deactivate the toxic NAPQI. This metabolite is then free to react with key hepatic enzymes, thereby damaging liver cells.

In those models there is no dynamic interaction between the universe at t < 0 and t > 0. , allowing an exchange of matter between the two conjugated sheets, based on an idea after Igor Dmitriyevich Novikov. Novikov called such singularities a collapse and an anticollapse, which are an alternative to the couple black hole and white hole in the wormhole model. Sakharov also proposed the idea of induced gravity as an alternative theory of quantum gravity.

The biliary tract, (biliary tree or biliary system) refers to the liver, gall bladder and bile ducts, and how they work together to make, store and secrete bile. Bile consists of water, electrolytes, bile acids, cholesterol, phospholipids and conjugated bilirubin. Some components are synthesised by hepatocytes (liver cells), the rest are extracted from the blood by the liver. Bile is secreted by the liver into small ducts that join to form the common hepatic duct.

Attack of the cyanide nucleophile occurs preferentially at a terminus of the butadiene fragment. (The drawing above shows the incorrect product) Following the rules given above, the butadiene fragment is an open ligand of even hapticity, which has greater reactivity than the allyl fragment, an open ligand of odd hapticity, or the cyclopentadiene, a closed ligand of odd hapticity. Attack occurs at the terminus which will result in the conjugated product shown.

Guanidinium is not a ring molecule, and is cross-conjugated rather than a π system of consecutively attached atoms, but is reported to have its six π-electrons delocalized over the whole molecule. The concept is controversial and some authors emphasize different effects. This has also been suggested as the reason that the trimethylenemethane dication is more stable than the butadienyl dication. σ-aromaticity refers to stabilization arising from the delocalization of sigma bonds.

As with ubiquitin and SUMO, NEDD8 is conjugated to cellular proteins after its C-terminal tail is processed. The NEDD8 activating E1 enzyme is a heterodimer composed of APPBP1 and UBA3 subunits. The APPBP1/UBA3 enzyme has homology to the N- and C-terminal halves of the ubiquitin E1 enzyme, respectively. The UBA3 subunit contains the catalytic center and activates NEDD8 in an ATP- dependent reaction by forming a high-energy thiolester intermediate.

On the other hand, streptavidin is the better biotin-conjugate binder; avidin has a lower binding affinity than streptavidin when biotin is conjugated to another molecule, despite avidin having the higher affinity for free, unconjugated biotin. Because streptavidin lacks any carbohydrate modification and has a near-neutral pI, it has the advantage of much lower nonspecific binding than avidin. Deglycosylated avidin (NeutrAvidin) is more comparable to the size, pI, and nonspecific binding of streptavidin.

Verbs are conjugated in singular and plural, unlike modern standard Swedish: "hån jär" (he is) but "di jåra" (they are), "hö löut se" (she leans herself) but "di lö:ut se" (they lean themselves), "je far" (I go) but "we fåra" (we go), "je vil" (I want) but "di vili" (they want). But there are irregular verbs which does not differ, e.g. "je liot fåra" (I have to go) / "we liot fåra" (we have to go).

DHT is inactivated in the liver and extrahepatic tissues like the skin into 3α-androstanediol and 3β-androstanediol by the enzymes 3α-hydroxysteroid dehydrogenase and 3β-hydroxysteroid dehydrogenase, respectively. These metabolites are in turn converted, respectively, into androsterone and epiandrosterone, then conjugated (via glucuronidation and/or sulfation), released into circulation, and excreted in urine. Unlike testosterone, DHT cannot be aromatized into an estrogen like estradiol, and for this reason, has no propensity for estrogenic effects.

Alkaline hydrogen peroxide is the most commonly used bleaching agent for mechanical pulp. The amount of base such as sodium hydroxide is less than that used in bleaching chemical pulps and the temperatures are lower. These conditions allow alkaline peroxide to selectively oxidize non-aromatic conjugated groups responsible for absorbing visible light. The decomposition of hydrogen peroxide is catalyzed by transition metals, and iron, manganese and copper are of particular importance in pulp bleaching.

Verbs which involve involuntary action or states are conjugated with the patient series. There are so many exceptions to this generalization, however, that one has to simply learn for each intransitive verb whether it takes the agent or the patient series. There is an additional rule for the intransitive verbs that take the agent series. When these verbs appear with stative aspect, they use the patient series rather than the agent series.

This incorporated two large single panes of glass either side of the boiler instead of the four smaller windows used on the N class.Haresnape (1983), p. 39 The inside cylinder was to be actuated by Holcroft's design of conjugated valve gear, which consisted of mechanical links fitted to both sets of outside Walschaerts gear, eliminating the need for a separate set of valve gear between the frames to operate the inside cylinder.Railway Engineer (1923), p.

PHEA can be used a plasma expander with good biocompatibility and biodegradability, high water solubility at low manufacturing costs and was investigated more intensive as a potential drug carrier) in medical applications.K. Seo, D. Kim: Design and synthesis of endosomolytic conjugated polyaspartamide for cytosolic drug delivery. In: E. Jabbari, A. Khademhosseini (Hrsg.): Biologically- responsive hybrid biomaterials: a reference for material scientists and bioengineers. World Scientific Publishing Co., Singapur 2010, , S. 191–212, .

All Spanish words can be classified into one of four groups based on the position of their stress. If the last syllable is stressed it falls into the aguda category. Aguda words generally end in a consonant other than n or s, or are a conjugated verb that ends in an accented, stressed vowel. If the stress falls on the second to last syllable, it is classified as a llana or grave.

LC3-I is conjugated to phosphatidylethanolamine (PE) also in a ubiquitin-like reaction that requires Atg7 and Atg3. The lipidated form of LC3, known as LC3-II, is attached to the autophagosome membrane. Autophagy and apoptosis are connected both positively and negatively, and extensive crosstalk exists between the two. During nutrient deficiency, autophagy functions as a pro-survival mechanism, however, excessive autophagy may lead to cell death, a process morphologically distinct from apoptosis.

After photoactivation it creates interstrand cross-links in DNA, which can cause programmed cell death unless repaired by cellular mechanisms. In research it can be conjugated to dyes for confocal microscopy and used to visualize sites of DNA damage. The compound is also being explored for development of antisense oligonucleotides that can be cross-linked specifically to a mutant mRNA sequence without affecting normal transcripts differing at even a single base pair.

Oxidation of this functional group leads to ketone formation, so IPN is formed. IPN can undergo oxidation of the furan ring by CYPs, like 4-IPO. After this bioactivation reaction, the product can be conjugated to glutathione (GSH) by glutathione-S-transferase (GST). Furthermore, 4-IPO can be reduced and DIOL is the product of this biotransformation. Finally, 4-IPO can interact with NADP+, forming a molecule which contains 4-IPO and NADPH.

UV/Vis spectroscopy is widely used as a technique in chemistry to analyze chemical structure, the most notable one being conjugated systems. UV radiation is often used to excite a given sample where the fluorescent emission is measured with a spectrofluorometer. In biological research, UV radiation is used for quantification of nucleic acids or proteins. A collection of mineral samples brilliantly fluorescing at various wavelengths as seen while being irradiated by UV light.

NH-1,2,3-triazoles are also prepared from alkynes in a sequence called the Banert cascade. The utility of the Cu(I)-catalyzed click reaction has also been demonstrated in the polymerization reaction of a bis-azide and a bis-alkyne with copper(I) and TBTA to a conjugated fluorene based polymer. The degree of polymerization easily exceeds 50. With a stopper molecule such as phenyl azide, well-defined phenyl end-groups are obtained.

Approximately 90% of precursors in estriol formation originate from the fetus. During pregnancy, 90 to 95% of estriol in the maternal circulation is conjugated in the form of estriol glucuronide and estriol sulfate, and levels of unconjugated estriol are slightly less than those of unconjugated estradiol and similar to those of unconjugated estrone. As such, target tissues are likely to be exposed to similar amounts of free estriol, estradiol, and estrone during pregnancy.

Like estradiol, estrone has poor oral bioavailability. It has been said that, taken by mouth in non- micronized form, a dose of 25 mg estrone is approximately equivalent to 2.5 mg conjugated estrogens, 50 µg ethinylestradiol, or 1 mg diethylstilbestrol in terms of estrogenic potency. Due to its weak oral activity, estrone has been used parenterally instead, for instance by intramuscular injection or vaginal administration. The pharmacokinetics of vaginal estrone have been studied.

CRC Press: Boca Raton, Florida, 1983; 2nd Ed. 1992. and introduced several molecular descriptors such as 3-dimensional Wiener index and Zagreb indices (with Ivan Gutman), who are one of the more studied topological indices. Independently of Jun-ichi Aihara, he introduced topological resonance energy as a reliable theory of aromaticity. In quantum chemistry he worked on semi-empirical molecular orbital theory and settling conjugated-circuit model on a firm quantum- mechanical basis.

20/63), claimed that in the dialect of the Hijaz, these demonstrative pronouns were indeclinable. # The absence of taltala. # The imperative of geminated verbs was conjugated as the strong verbs, e.g. urdud ‘respond!’. Syntactic features of this dialect include: # Some nouns were feminine in the Hijaz and masculine in the Najd and Tamīm. Some examples are tamr ‘dates’, šaˁīr ‘barley’, ṣirāṭ ‘path’. The word ṣirāṭ appears in the first sūra of the Qurān (Q.

Most studies of CLAs have used a mixture of isomers wherein the isomers c9,t11-CLA (rumenic acid) and t10,c12-CLA were the most abundant. More recent studies using individual isomers indicate that the two isomers have very different health effects. Conjugated linoleic acid is both a trans fatty acid and a cis fatty acid. The cis bond causes a lower melting point and, ostensibly, also the observed beneficial health effects.

By reconstituting SpyTag:SpyCatcher, the resulting conjugated complex acquires the stability of the parent CnaB2 domain. A second generation SpyTag/SpyCatcher called SpyTag002/SpyCatcher002 was then created through phage display that enables the peptide-protein pair to react up to 12 times faster than the original pair, at a rate constant of 2.0 ± 0.2 × 104 M−1 s−1. The second generation SpyCatcher002 also has abolished self-reactivity that is present with SpyCatcher.

With a high number of verb tenses, and many verb forms that are not found in English, Spanish verbs can be hard to remember and then conjugate. The use of mnemonics has been proven to help students better learn foreign languages, and this holds true for Spanish verbs. A particularly hard verb tense to remember is command verbs. Command verbs in Spanish are conjugated differently depending on who the command is being given to.

Dmitrii "Dima" F. Perepichka (born 1972) is the Chair of Chemistry Department and Sir William C. MacDonald Chair Professor in Chemistry at McGill University. His research interest are primarily in the area of organic electronics. He has contributed in the understanding of structural electronics effects of organic conjugated materials at molecular, supramolecular, and macromolecular levels via the study of small molecules, supramolecular (co-)assemblies, polymers, covalent organic frameworks, and on-surface assemblies/polymers.

Early Middle Japanese verb inflection was agglutinative. All verbs were conjugated in a small number of 'stems' and could be combined with grammaticalized verbs to express tense, aspect, mood, voice, and polarity. Several of the grammaticalized verbs could combine in a string, and each component determined the choice of stem of the preceding component. A small number of other grammatical endings were not verbs but carried various co-ordinating or subordinating functions.

The human monoclonal antibody is conjugated via a cleavable linker to a cytotoxic (anticancer) pyrrolobenzodiazepine (PBD) dimer. The antibody binds to CD25, which is the alpha chain of the interleukin 2 receptor IL2RA. This molecule is expressed mainly on activated T- and B-cells, both of which are types of white blood cells that play a role in the human immune system. CD25 is over-expressed in a wide range of hematological malignancies, such as leukemias and lymphomas.

KLH is being tested in a variety of cancer vaccines, including non- Hodgkin's lymphoma, cutaneous melanoma, breast and bladder cancer. These vaccines contain specific tumor-associated antigens conjugated to KLH to stimulate anti-tumor immune responses which can destroy tumor cells. The rapidly growing interest in therapeutic vaccines (i.e. active immunotherapies) for cancer and the documented efficacy of KLH as a superior carrier protein for cancer vaccines are creating a significant biopharmaceutical market for KLH formulations.

Some trans fatty acids occur in natural fats and traditionally processed foods. Vaccenic acid occurs in breast milk, and some isomers of conjugated linoleic acid (CLA) are found in meat and dairy products from ruminants. Butter, for example, contains about 3% trans fat. The US National Dairy Council has asserted that the trans fats present in animal foods are of a different type than those in partially hydrogenated oils, and do not appear to exhibit the same negative effects.

In order to overcome these obstacles, protein or peptide labeling can be performed through a prosthetic group or bifunctional labeling agent to which the radiofluorine has been attached. This molecule can then be conjugated to the protein or peptide under milder conditions. center The three main categories of prosthetic groups are carboxyl-reactive, amino- reactive, and thiol-reactive. Of these three, the carboxyl-reactive group is the least utilized, and the amino-reactive is the most utilized.

A major example of this class of fluorescent stain is phalloidin, which is used to stain actin fibers in mammalian cells. A new peptide, known as the Collagen Hybridizing Peptide, can also be conjugated with fluorophores and used to stain denatured collagen fibers. Staining of the plant cell walls is performed using stains or dyes that bind cellulose or pectin. The quest for fluorescent probes with a high specificity that also allow live imaging of plant cells is ongoing.

A central feature of Actran was the use of Infinite Elements (IE) as an alternative to BEM for modelling non-reflecting boundary conditions and calculating the far field. Actran uses conjugated infinite elements, an extension of the wave envelope technique.Astley, R. J., Macaulay, G. J., & Coyette, J. P. (1994). Mapped wave envelope elements for acoustical radiation and scattering. Journal of Sound and Vibration, 170(1), 97-118.Astley, R. J., Macaulay, G. J., Coyette, J. P., & Cremers, L. (1998).

Chemically, carotenes are polyunsaturated hydrocarbons containing 40 carbon atoms per molecule, variable numbers of hydrogen atoms, and no other elements. Some carotenes are terminated by hydrocarbon rings, on one or both ends of the molecule. All are coloured to the human eye, due to extensive systems of conjugated double bonds. Structurally carotenes are tetraterpenes, meaning that they are synthesized biochemically from four 10-carbon terpene units, which in turn are formed from eight 5-carbon isoprene units.

This and other evidence (such as NMR in superacid solutions) shows that the intermediate carbocation must have a highly delocalized structure, different from its mostly classical (delocalization exists but is small) parent molecule. This cation (an allylic cation) can be represented using resonance, as shown above. This observation of greater delocalization in less stable molecules is quite general. The excited states of conjugated dienes are stabilised more by conjugation than their ground states, causing them to become organic dyes.

Only the cells incubated with the gold nanoshells conjugated with the specific antibody (anti-HER2) were damaged by the laser. Another category of gold nanoshells are gold layer on liposomes, as soft template. In this case, drug can also be encapsulated inside and/or in bilayer and the release can be triggered by laser light. Gold is often used because it is a good absorber of light energy, it is tunable, non-biodegradable, and has imaging properties.

Japanese adjectives, specifically i-adjectives, function grammatically as verbs, though with more limited conjugation. There are a few irregularities of note. Most significantly, 良い yoi "good" is generally replaced by ii in the base form (yoi is found in formal usage), though only yoi is used in conjugated forms such as 良く yoku and 良くない yokunai. There are more minor and subtler irregularities in certain constructions, particularly in adjectives with single-mora roots.

The oxidative reaction by Cytochrome-P450 enzymes will lead to the formation of an epoxide intermediate, which shows reactivity. This epoxide intermediate is highly unstable and could lead to the formation of cyanide via different transformations. For example via epoxide hydratase (EH) or via interactions with a sulfhydryl compound, which leads to the formation of a cyanohydrin that could rearrange to an aldehyde and thereby can possibly result in cyanide release. The epoxide can also be conjugated with GSH.

Microfiber products used for consumer cleaning are generally constructed from split conjugated fibers of polyester and polyamide. Microfiber used for commercial cleaning products also includes many products constructed of 100% polyester. Microfiber products have exceptional ability to absorb oils, and are not hard enough to scratch even paintwork unless they have retained grit or hard particles from previous use. Due to hydrogen bonding, microfibre cloth containing polyamide absorbs and holds more water than other types of fibres.

AZ01 is currently undergoing Phase I clinical trials in the US. Preclinical data indicates that AZ01 has the potential to be dosed once monthly compared to the current standard of care dosed anywhere from once daily to once per week. Allozyne's technology also enables the development of next generation antibody-drug conjugates (ADCs). This approach results in homogenous ADC products that are stably conjugated. In 2014, Allozyne was acquired by MedImmune, based on its ADC technology.

A pre-amplifier molecule hybridizes to each oligo pair on the target-specific RNA, then multiple amplifier molecules hybridize to each pre-amplifier. Next, multiple label probe oligonucleotides (conjugated to alkaline phosphatase or directly to fluorophores) hybridize to each amplifier molecule. A fully assembled signal amplification structure “Tree” has 400 binding sites for the label probes. When all target-specific probes bind to the target mRNA transcript, an 8,000 fold signal amplification occurs for that one transcript.

Pentachlorophenol may be measured in plasma or urine as an index of excessive exposure. This is usually performed by gas chromatography with electron-capture or mass-spectrometric detection. Since urine contains predominantly conjugated PCP in chronic exposure situations, prior hydrolysis of specimens is recommended. The current ACGIH biological exposure limits for occupational exposure to PCP are 5 mg/l in an end-of-shift plasma specimen and 2 mg/g creatinine in an end-of-shift urine specimen.

They are usually processed from solution employing variable deposition techniques including simple spin-coating, ink-jet deposition or industrial reel-to-reel coating which allows preparing thin films on a flexible substrate. The materials of choice are conjugated polymers such as poly- thiophene, poly-phenylenevinylene, and copolymers of alternating donor and acceptor units such as members of the poly(carbazole-dithiophene- benzothiadiazole (PCDTBT) family. For solar cell applications they can be blended with C60 or PCBM as electron acceptors.

Beta-glucuronidases are members of the glycosidase family of enzymes that catalyze breakdown of complex carbohydrates. Human β-glucuronidase is a type of glucuronidase (a member of glycosidase Family 2) that catalyzes hydrolysis of β-D-glucuronic acid residues from the non-reducing end of mucopolysaccharides (also referred to as glycosaminoglycans) such as heparan sulfate. Human β-glucuronidase is located in the lysosome. In the gut, brush border β-glucuronidase converts conjugated bilirubin to the unconjugated form for reabsorption.

Allowing derivatives and clitics allows the already lengthy word to grow even longer, although the usability of the word starts to degrade. Because Finnish uses free forming of composite words, new words can even be formed during a conversation. One can add nouns after each other without breaking grammar rules. If one allows artificial constructs as well as using clitics and conjugated forms, one can create even longer words: such as (102 letters), which was created by Artturi Kannisto.

During culture, supernatant (containing idiotype) is collected until sufficient amounts have been produced to yield adequate dosage of vaccine. This supernatant is purified by affinity chromatography and conjugated (bonded) to keyhole limpet haemocyanin (KLH), an immune-stimulating carrier protein, resulting in a finished vaccine that can be shipped and administered to patients. In the Phase III clinical trial, manufacturing success was approximately 95% of treated patients. The BiovaxID vaccine is manufactured through a process known as rescue fusion hybridization.

Estrone is conjugated into estrogen conjugates such as estrone sulfate and estrone glucuronide by sulfotransferases and glucuronidases, and can also be hydroxylated by cytochrome P450 enzymes into catechol estrogens such as 2-hydroxyestrone and 4-hydroxyestrone or into estriol. Both of these transformations take place predominantly in the liver. Estrone can also be reversibly converted into estradiol by 17β-HSD. The blood half-life of estrone is about 10 to 70 minutes and is similar to that of estradiol.

The name leukotriene, introduced by Swedish biochemist Bengt Samuelsson in 1979, comes from the words leukocyte and triene (indicating the compound's three conjugated double bonds). What would be later named leukotriene C, "slow reaction smooth muscle-stimulating substance" (SRS) was originally described between 1938 and 1940 by Feldberg and Kellaway. The researchers isolated SRS from lung tissue after a prolonged period following exposure to snake venom and histamine. Leukotrienes are commercially available to the research community.

Codorphone synthesis: Exposure of thebaine (1) to mild acid leads to hydrolysis of the enol ether function followed by migration of the double bond to yield the conjugated enone (2). Addition of lithium diethylcuprate proceeds by 1,4-addition from the less hindered side to give the intermediate 3. Treatment of that with cyanogen bromide under von Braun reaction conditions leads to the isolable aminocyanide. This is the converted to the secondary amine (4) by treatment with aqueous base.

Verbs are conjugated for singular and plural number and first, second, and third persons. There are 11 verb tenses: present comprehensive (long and short form), present perfect (regular and negative), future certain, future indefinite, conditional, past definite, obligatory, imperative, and intentional. There are two types of verbs in Turkmen, distinguished by their infinitive forms: those ending in the suffix "-mak" and those ending in "-mek". -Mak verbs follow back vowel harmony, whereas -mek verbs follow front vowel harmony.

Middlemass, (Backtrack: 4), pp. 148-154 The Holcroft variant held an advantage over Gresley's "conjugated" design, as the valve timing was immune to variations brought about by heat expansion of the valve spindles and flexing of the conjugation assembly when under heavy use.Holcroft, (Engineer: 181, 1946), pp. 145-147 It also had potential maintenance benefits because most of the conjugation mechanism was located outside the locomotive frames and could thus be accessed without an inspection pit.

Addition reactions occur when nucleophiles react with carbonyls. When a nucleophile adds to a simple aldehyde or ketone, the result is a 1,2-addition. When a nucleophile adds to a conjugated carbonyl system, the result is a 1,4-addition. The designations 1,2 and 1,4 are derived from numbering the atoms of the starting compound where the oxygen is labeled “1” and each atom adjacent to the oxygen are sequentially numbered out to the site of nucleophilic addition.

Many products marketed as botanical weight loss supplements actually contain unapproved stimulants including analogues of amphetamine, methamphetamine and ephedra. Some botanical supplements include high dosages of compounds found in plants with stimulant effects including yohimbine and higenamine. Canadian clinical practice guidelines state that there is insufficient evidence to recommend in favor of or against using herbal medicine, dietary supplements or homeopathy against obesity. Conjugated linoleic acid is claimed to help reduce obesity but it is ineffective for this use.

SISH uses a similar method as CISH, but a silver precipitate is the end product rather than a brown product. In this method, a probe tagged with dinitrophenol (DNP) binds to the target sequence. A primary anti-DNP antibody is then added followed by a secondary antibody conjugated to HRP. Silver acetate, hydroquinone, and hydrogen peroxide are subsequently added to the secondary antibody and HRP catalyzes the polymerization of silver in the presence of hydrogen peroxide.

In Tigrinya there are four possibilities, conventionally referred to as perfect, imperfect, jussive/imperative, and gerundive. Once a lexical root, possibly altered through the addition of a derivational element, has been assigned a basic TAM, it becomes a pronounceable stem, though still not a complete word. For example, {sbr}+PASSIVE 'be broken' in the imperfect becomes sǝbbär 'is broken'. ; Conjugation : Semitic verbs are conjugated; that is, they agree with the verb's subject in person, number, and gender.

The term has been attributed mainly to African- American slang, in which it holds various meanings.Oxford English Dictionary It most commonly refers to the verb phrase "to crank up". It is theorized that the use of the term came from a past-tense form of "crank", which was sometimes conjugated as "crunk" in the South, such that if a person, event, or party was hyped-up, i.e. energetic - "cranked" or "cranked up" - it was said to be "crunk".

Except for the infinitive and gerund, these forms are conjugated to reflect the number (singular or plural), person (first, second, or third) and gender (masculine or feminine) of its subject, depending on the form. Modern Hebrew also has an analytic conditional~past-habitual mood expressed with the auxiliary haya. In listings such as dictionaries, Hebrew verbs are sorted by their third-person masculine singular past tense form. This differs from English verbs, which are identified by their infinitives.

The Tersoff's model could describe single, double and triple bond energies in carbon structures such as in hydrocarbons and diamonds. A significant step was taken by Brenner in 1990. He extended Tersoff's potential function to radical and conjugated hydrocarbon bonds by introducing two additional terms into the bond order function. Compared to classical first-principle and semi-empirical approaches, the REBO model is less time-consuming, since only the 1st- and 2nd-nearest-neighbour interactions were considered.

Chitosan as drug delivery: Chitosan is used mainly with drug targeting because it has potential to improve drug absorption and stability. in addition Chitosan conjugated with anticancer agents can also produce better anticancer effects by causing gradual release of free drug into cancerous tissue. Chitosan as an anti-microbial agent: Chitosan is used to stop the growth of microorganisms. It performs antimicrobial functions in microorganisms like algae, fungi, bacteria, and gram positive bacteria of different yeast species.

Punctuation marks are seen more often within African-American names than other American names, such as the names Mo'nique and D'Andre. In his dictionary of Black names, Cenoura asserts that in the early 21st century, Black names are "unique names that come from combinations of two or more names, names constructed with common prefixes and suffixes...'conjugated' with a formula..."Cenoura B. Black. Names Matter: The Black Names Book. Bobby Cenoura and Slice of Pain Publishing and Media; 2015.

Antibody-conjugated polystyrene particles were loaded in the middle of the microfluidic channel, after the sample inlet. Immunoagglutination occurs when samples containing Salmonella or E. coli, respectively, come into contact with these particles. The amount of immunoagglutination can be correlated with increased Mie scattering of light, which was detected with a specialized smartphone application under ambient light. Paper-based microfluidics has also been used to detect pesticides in food products, such as apple juice and milk.

In addition to these two aspectual distinctions, Breton has a habitual present which utilises the present habitual of bezañ and the present participle. Combining the past participle with either eus or bezañ is the usual way of forming the past tense, the conjugated forms being restricted to more literary language. The choice between eus or bezañ depends on whether the past participle is that of a transitive or intransitive verb respectively (similar to the passé composé of French).

In the second reaction, biliverdin is converted to bilirubin by biliverdin reductase (BVR): Bilirubin is transported into the liver by facilitated diffusion bound to a protein (serum albumin), where it is conjugated with glucuronic acid to become more water-soluble. The reaction is catalyzed by the enzyme UDP- glucuronosyltransferase. This form of bilirubin is excreted from the liver in bile. Excretion of bilirubin from liver to biliary canaliculi is an active, energy-dependent and rate-limiting process.

The heme iron serves as a source or sink of electrons during electron transfer or redox chemistry. In peroxidase reactions, the porphyrin molecule also serves as an electron source, being able to delocalize radical electrons in the conjugated ring. In the transportation or detection of diatomic gases, the gas binds to the heme iron. During the detection of diatomic gases, the binding of the gas ligand to the heme iron induces conformational changes in the surrounding protein.

In addition to the major fatty acid components, palmitic acid, oleic acid and linoleic acid, C. cristata contains two unusual fatty acids, cis-9, cis-14-octadecadien-12-ynoic acid, and the conjugated cis-9, trans-11, trans-13, cis-15-octadecatetraenoic acid (commonly known as α-parinaric acid).Endo S, Zhiping G, Takagi T. (1991). Lipid components of seven species of Basidiomycotina and three species of Ascomycotina. Journal of the Japan Oil Chemists' Society 40(7): 574–77.

Aceclofenac (C16H13Cl2NO4), chemically [(2-{2, 6-dichlorophenyl) amino} phenylacetooxyacetic acid], is a crystalline powder with a molecular weight of 354.19. It is practically insoluble in water with good permeability. It is metabolized in human hepatocytes and human microsomes to form [2-(2',6'-dichloro-4'-hydroxy- phenylamino) phenyl] acetoxyacetic acid as the major metabolite, which is then further conjugated. According to the Biopharmaceutical Classification System (BCS) drug substances are classified to four classes upon their solubility and permeability.

Aromatic molecules need not be neutral molecules. Ions that satisfy Huckel's rule of 4n + 2 π-electrons in a planar, cyclic, conjugated molecule are considered to be aromatic ions. For example, the cyclopentadienyl anion and the cycloheptatrienylium cation are both considered to be aromatic ions, and the azulene molecule can be approximated as a combination of both. In order to convert the atom from sp3 to sp2, a carbocation, carbanion, or carbon radical must be formed.

If antibodies that bind to antigen are present then they will remain after washing. A secondary anti- human antibody conjugated to an enzyme such as horseradish peroxidase is added. The enzyme reaction will produce a change in colour of the solution that is proportional to the amount of antibody bound to the antigen. There are significant differences in the detection of ANA by immunofluorescence and different ELISA kits and there is only a marginal agreement between these.

NEDD8 is a protein that in humans is encoded by the NEDD8 gene. (In Saccharomyces cerevisiae this protein is known as Rub1.) This ubiquitin-like protein (ULP), becomes covalently conjugated to a limited number of cellular proteins in a manner analogous to ubiquitination. Human NEDD8 shares 60% amino acid sequence identity to ubiquitin. The primary known substrates of NEDD8 modification are the Cullin subunits of Cullin-based E3 ubiquitin ligases, which are active only when neddylated.

Homoconjugation weakens the double bond character of the C=O bond, resulting in a lower IR frequency.There are also other types of interactions that generalize the idea of interacting p orbitals in a conjugated system. The concept of hyperconjugation holds that certain σ bonds can also delocalize into a low-lying unoccupied orbital of a π system or an unoccupied p orbital. Hyperconjugation is commonly invoked to explain the stability of alkyl substituted radicals and carbocations.

This principle is also being studied for cancer treatment application. Several groups have encapsulated anti-cancer medications such as: Camptothecin, Methotrexate, and Doxorubicin. Results from these research has shown that dendrimers have increased aqueous solubility, slowed release rate, and possibly control cytotoxicity of the drugs. Cisplatin has been conjugated to PAMAM dendrimers that resulted in the same pharmacological results as listed above, but the conjugation also helped in accumulating cisplatin in solid tumors in intravenous administration.

Ileal sodium/bile acid cotransporter, also known as apical sodium–bile acid transporter (ASBT) and ileal bile acid transporter (IBAT), is a bile acid:sodium symporter protein that in humans is encoded by the SLC10A2 gene. ASBT/IBAT is most highly expressed in the ileum, where it is found on the brush border membrane of enterocytes. It is responsible for the initial uptake of bile acids, particularly conjugated bile acids, from the intestine as part of their enterohepatic circulation.

Yttrium (90Y) clivatuzumab tetraxetan (trade name hPAM4-Cide) is a humanized monoclonal antibody-drug conjugate designed for the treatment of pancreatic cancer. The antibody part, clivatuzumab (targeted at MUC1), is conjugated with tetraxetan, a chelator for yttrium-90,WHO Drug Information a radioisotope which destroys the tumour cells. The drug was developed by Immunomedics, Inc. In March 2016 the phase III PANCRIT-1 trial in metastatic pancreatic cancer was terminated early due to lack of improvement of overall survival.

This causes the antibodies to show specificity for a single epitope. For immunohistochemical detection strategies, antibodies are classified as primary or secondary reagents. Primary antibodies are raised against an antigen of interest and are typically unconjugated (unlabeled), while secondary antibodies are raised against immunoglobulins of the primary antibody species. The secondary antibody is usually conjugated to a linker molecule, such as biotin, that then recruits reporter molecules, or the secondary antibody itself is directly bound to the reporter molecule.

Obesity increases the risk of VTE as well. Increased risk of VTE with estrogens is thought to be due to their influence on liver protein synthesis, specifically on the production of coagulation factors. Non- bioidentical estrogens such as conjugated estrogens and especially ethinylestradiol have markedly disproportionate effects on liver protein synthesis relative to estradiol. In addition, oral estradiol has a 4- to 5-fold increased impact on liver protein synthesis than does transdermal estradiol and other parenteral estradiol routes.

The enedial intermediate is toxic, as it can bind to proteins. However, it can be detoxified in phase II metabolism, in which the enedial can be conjugated with either N-acetyl lysine (NAL) or N-acetyl cysteine (NAC). This results in a NAL/NAC-IPO adduct, which can be excreted. Furthermore, 4-IPO can directly undergo phase II metabolism, by conjugating glucuronosyl to the hydroxyl group of 4-IPO by uridine 5’-diphospho-glucuronosyltransferase (UGT), forming 4-IPO glucuronide.

The ultimate goal of Yoga is Moksha (liberation), although the exact form this takes depends on the philosophical or theological system with which it is conjugated. In the classical Astanga yoga system, the ultimate goal of yoga practice is to achieve the state of Samadhi and abide in that state as pure awareness. According to Jacobsen, Yoga has five principal traditional meanings: # A disciplined method for attaining a goal. # Techniques of controlling the body and the mind.

These related molecules have novel functions and influence diverse biological processes. There is also cross-regulation between the various conjugation pathways, since some proteins can become modified by more than one UBL, and sometimes even at the same lysine residue. For instance, SUMO modification often acts antagonistically to that of ubiquitination and serves to stabilize protein substrates. Proteins conjugated to UBLs are typically not targeted for degradation by the proteasome but rather function in diverse regulatory activities.

A subordinate clause (Nebensatz) is always incorporated in a main clause (or another subordinate clause). Any part of the main clause can be replaced by it, but some conjugated verb must remain. However, subclauses are generally moved to the end of the sentence if it can be done without inconvenience and they do not take the first place because of importance. As for word order, it differs in two things only from a main clause: 1\.

The benzenoid hydrocarbons have been defined as condensed polycyclic unsaturated fully-conjugated hydrocarbons whose molecules are essentially planar with all rings six-membered. Full conjugation means that all carbon atoms and carbon-carbon bonds must have the sp2 structure of benzene. This class is largely a subset of the alternant PAHs, but is considered to include unstable or hypothetical compounds like triangulene or heptacene. As of 2012, over 300 benzenoid hydrocarbons had been isolated and characterized.

Verbs were conjugated according to three moods (indicative, subjunctive (conjunctive) and imperative), three persons, two numbers (singular and plural) and two tenses (present tense and preterite) There was a present participle, a past participle and a verbal noun that somewhat resembles the Latin gerund, but that only existed in the genitive and dative cases. An important distinction is made between strong verbs (that exhibited ablaut) and weak verbs (that didn't). Furthermore, there were also some irregular verbs.

EE is an estrogen similarly to natural estrogens like estradiol and conjugated estrogens (Premarin) and synthetic estrogens like diethylstilbestrol. It binds to and activates both isoforms of the estrogen receptor, ERα and ERβ. In one study, EE was found to have 233% and 38% of the affinity of estradiol for the ERα and ERβ, respectively. In another study, it was found to possess 194% and 151% of the affinity of estradiol for the ERα and ERβ, respectively.

FePt Coercivity Due to their superparamagnetism and controllable shape, size, and surface, iron-platinum nanoparticles have great potential for advancing medicine in many fields, including imagining, pathogen detection, and targeted cancer therapy. The NPs can be conjugated with antibodies for tissue-specific delivery, providing a systematic way to customize for either technology. FePt NPs are compatible for CT scans because of their strong ability to absorb x-rays.Page for X-Ray Mass Attenuation Coefficients for Pt. .

Chamberland et al studied the use of anti-TNF conjugated gold nanorods (AuNRs) ex vivo in rat tail joints to reduce the effect of rheumatoid arthritis. They observed the effects of the drug delivery system via PAT technology. The properties of the AuNRs found to be the most efficient had measurements of 45 x 15 nm with an absorption peak of 660 nm. This tuning allowed for better contrast between the targeted areas and intra-articular tissue.

"Historical Background (or there is nothing new under the Sun)" in György Inzelt "Conducting Polymers" Springer, 2008, Berlin, Heidelberg. Most conductive polymers are derivatives of polyacetylene, polyaniline, polypyrrole or polythiophenes.Skotheim, Terje A. Reynold, John "Handbook of Conducting Polymers" CRC Press, 1998 These polymers have conjugated double bonds which allow for conduction. By manipulating the band structure, polythiophenes have been modified to achieve a HOMO-LUMO separation (bandgap) that is large enough to make them transparent to visible light.

Intoxication of mice with microcystin-LR led to a decrease in the levels of cytochrome P450 and cytochrome b5 and an increase in cytochrome P420, to which CYP450 is converted. Together with the fact that mice with an induced higher concentration CYP450 are less affected by the toxin, this suggest that CYP450 plays an important role in the detoxification of the compound. In phase 2 of the biotransformation the compound is conjugated with several different endogenous substances.

Morpholino antisense oligos conjugated to cell penetrating peptides have been shown to partially protect mice from WNV disease. There have also been attempts to treat infections using ribavirin, intravenous immunoglobulin, or alpha interferon. GenoMed, a U.S. biotech company, has found that blocking angiotensin II can treat the "cytokine storm" of West Nile virus encephalitis as well as other viruses. As of 2019, six vaccines had progressed to human trials but none had been licensed in the United States.

Hiragana are used for words without kanji representation, for words no longer written in kanji, and also following kanji to show conjugational endings. Because of the way verbs (and adjectives) in Japanese are conjugated, kanji alone cannot fully convey Japanese tense and mood, as kanji cannot be subject to variation when written without losing their meaning. For this reason, hiragana are appended to kanji to show verb and adjective conjugations. Hiragana used in this way are called okurigana.

Afrikaans has dropped the simple past tense for all but a few verbs, of which five are modals, hence kon ("could") from kan or "can" and moes or "should" from moet or "must"; instead, it generally uses either the present perfect or the present tense, depending on context, the latter being used as the historical present. It has also lost the pluperfect, conjugated using had, no longer used, with the present perfect, conjugated with het, being used instead. Consequently, the sentence ek het die boek vir haar gegee in Afrikaans can be translated into Dutch as ik heb het boek aan haar gegeven ("I have given the book to her") ik gaf het boek aan haar ("I gave the book to her") or ik had het boek aan haar gegeven ("I had given the book to her"). However, the verb dink ("to think") still makes use of a simple past tense; for example, instead of ek het gedink to mean "I thought", ek dag or ek dog, similar to Dutch ik dacht, is sometimes used instead.

These differences are due to the introduction of an ethynyl group at the C17α position in ethinylestradiol (also known as 17α-ethynylestradiol), which results in steric hindrance and greatly diminishes the first-pass metabolism of ethinylestradiol relative to estradiol with oral administration. Estradiol and ethinylestradiol have similar affinities for and efficacies as agonists of the ERs, and the systemic estrogenic potency of estradiol and ethinylestradiol is similar when they are administered by the intravenous route. Synthetic estrogens like ethinylestradiol and diethylstilbestrol and the natural but animal-derived conjugated estrogens have disproportionate effects on liver protein synthesis relative to their effects in other tissues when compared to estradiol. At doses via the oral route with comparable systemic estrogenic potency, conjugated estrogens have about 1.3 to 4.5 times the hepatotropic potency (i.e., potency in modulating liver protein synthesis) of estradiol, ethinylestradiol has about 2.9 to 5.0 times the hepatotropic potency of estradiol, and diethylstilbestrol shows about 5.7 to 7.5 times the hepatotropic potency of estradiol (all measured via a small selection of estrogen-modulated hepatic proteins that included cholesterol, , , and angiotensinogen).

When combined with the free radical-forming TCNQ as an acceptor molecule, it can mimic the mechanism of metallic magnets. The magnetic properties arise from the fully pi-conjugated nitrogen-containing backbone combined with molecular charge transfer side groups. These properties cause the molecule to have a high density of localized spins that can give rise to coupling of their magnetic fields. When this polymer magnet is synthesized, the polymer chains need 3 months to line up before displaying any notable magnetism.

This is especially important when working with brain tumor models, which are notoriously hard to study. Strengths: Micro-PAT can be described as an imaging modality that is applicable in a wide variety of functions. It combines the high sensitivity of optical imaging with the high spatial resolution of ultrasound imaging. For this reason, it can not only image structure, but also separate between different tissue types, study hemodynamic responses, and even track molecular contrast agents conjugated to specific biological molecules.

Due to the presence of these metabolites, people taking selegiline may test positive for "amphetamine" or "methamphetamine" on drug screening tests. While the amphetamine metabolites may contribute to selegiline's ability to inhibit reuptake of the neurotransmitters dopamine and norepinephrine, they have also been associated with orthostatic hypotension and hallucinations. The amphetamine metabolites are hydroxylated and, in phase II, conjugated by glucuronyltransferase. A newer anti-Parkinson MAO-B inhibitor, rasagiline, metabolizes into 1(R)-aminoindan, which has no amphetamine-like characteristics.

As a result, multiple amplification events can be initiated, producing multiple RCA products ("Multiprimed RCA"). # Amplification product detection and visualization, which is most commonly conducted through fluorescent detection, with fluorophore-conjugated dNTP, fluorophore-tethered complementary or fluorescently-labeled molecular beacons. In addition to the fluorescent approaches, gel electrophoresis is also widely used for the detection of RCA product. RCA produces a linear amplification of DNA, as each circular template grows at a given speed for a certain amount of time.

17β-Dihydroequilin is a naturally occurring estrogen sex hormone found in horses as well as a medication. As the C3 sulfate ester sodium salt, it is a minor constituent (1.7%) of conjugated estrogens (CEEs; brand name Premarin). However, as equilin, with equilin sulfate being a major component of CEEs, is transformed into 17β-dihydroequilin in the body, analogously to the conversion of estrone into estradiol, 17β-dihydroequilin is, along with estradiol, the most important estrogen responsible for the effects of CEEs.

This activation step results in the formation of a high-energy thiolester bond in the presence of ATP. The Ufm1 is subsequently transferred to its cognate E2-like enzyme (Ufc1) via a similar thioester linkage with a cysteine at the E2 active site. Ufm1 is conjugated to a variety of target proteins and forms complexes with as yet unidentified proteins. Thus, presumably there exist E3 ligases (none have been identified to date) to perform the final step in Ufm1 conjugation to relevant targets.

A general dot blot protocol involves spotting 1–2 microliters of a samples onto a nitrocellulose or PVDF membrane and letting it air dry. Samples can be in the form of tissue culture supernatants, blood serum, cell extracts, or other preparations. The membrane is incubated in blocking buffer to prevent non-specific binding. It is then incubated with a primary antibody followed by a detection antibody or a primary antibody conjugated to a detection molecule (commonly HRP or alkaline phosphatase).

Hepatic jaundice (hepatocellular jaundice) is due to significant damage to liver function → hepatic cell death and necrosis occur → impaired bilirubin transport across hepatocytes. Bilirubin transport across hepatocytes may be impaired at any point between hepatocellular uptake of unconjugated bilirubin and hepatocellular transport of conjugated bilirubin into the gallbladder. In addition, subsequent cellular edema due to inflammation causes mechanical obstruction of intrahepatic biliary tract. Most commonly, interferences in all three major steps of bilirubin metabolism — uptake, conjugation, and excretion — usually occur in hepatocellular jaundice.

In 2012, María Antonia Herrero obtained a grant from the Iberdrola Foundation to develop a project in the field of energy and the environment. The project, headed by Herrero, proposed the preparation of a device that uses solar energy to produce electricity and wastewater regeneration through integrated electrochemical processes fed by renewable energies, thus contributing to the fight against climate change. In July 2016 she published research on Design of Assembled Systems Based on Conjugated Polyphenylene Derivatives and Carbon Nanohorns.

Arcitumomab is a mouse antibody that recognizes Carcinoembryonic antigen, an antigen over-expressed in 95% of colorectal cancers. It is conjugated to a radioactive element, which will label the tumors when viewed with single-photon emission computed tomography. Sulesomab, an antigen that recognizes proteins on the surface of granulocytes, is used to label out infections, again using the 99mTc isotope. Fab fragments are often fused to small proteins (<100 kDa) that have lower scattering, resulting in images with less contrast.

Inset shows the dotted area above it without the PKH26 channel overlaid, revealing the concentration of RTX-Al488 at the cell-cell interface, otherwise depleted from the rest of the Ramos cell. Trogocytosis reaction was halted by fixation 45 min after co-incubation. Ramos cells are approximately 12 μm in diameter. Trogocytosis (; gnaw) is a process whereby lymphocytes (B, T and NK cells) conjugated to antigen-presenting cells extract surface molecules from these cells and express them on their own surface.

Tropone or 2,4,6-cycloheptatrien-1-one is an organic compound with some importance in organic chemistry as a non-benzenoid aromatic. The compound consists of a ring of seven carbon atoms with three conjugated alkene groups and a ketone group. The related compound tropolone (2-hydroxy-2,4,6-cycloheptatrien-1-one) has an additional alcohol (or an enol including the double bond) group next to the ketone. The tropone moiety can be found in biomolecules such as colchicine, stipitatic acid and hinokitiol.

A sigmatropic rearrangement is a reaction in which a sigma bond moves across a conjugated pi system with a concomitant shift in the pi bonds. The shift in the sigma bond may be antarafacial or suprafacial. In the example of a [1,5] shift in pentadiene, if there is a suprafacial shift, there is 6 e− moving suprafacially and none moving antarafacially, implying this reaction is allowed by the Woodward–Hoffmann rules. For an antarafacial shift, the reaction is not allowed.

In this method the Pol a-synthesized primer is removed. Studies show that in the FEN1 suggest a ‘tracking; model where the nuclease moves from the 5’ flap to its base to preform cleavage. The Pol δ does not process a nuclease activity to cleave the displaced flap. The FEN1 cleaves the short flap immediately after they form. The cleavage is inhibited when the 5’ end of the DNA flap is blocked either with a complementary primer or a biotin-conjugated streptavidin moiety.

Bevacizumab can also be combined with platinum chemotherapy, a combination that has had positive preliminary results in PFS, but equivocal results regarding overall survival. One disadvantage to these treatments is the side effect profile, which includes high blood pressure and proteinuria. The drug can also exacerbate bowel disease, leading to fistulae or bowel perforation. Vintafolide, which consists of an antifolate conjugated with vinblastine, is also in clinical trials; it may prove beneficial because folate receptors are overexpressed in many ovarian cancers.

It is an accessory pigment found in the chloroplasts of many brown macroalgae, such as Fucus spp., and the golden-brown unicellular microalgae, the diatoms. It absorbs blue and green light at bandwidth 450-540 nm, imparting a brownish-olive color to algae. Fucoxanthin has a highly unique structure that contains both an epoxide bond and hydroxyl groups along with an allenic bond (carbon-carbon double bond) and a conjugated carbonyl group (carbon-oxygen double bond) in the polyene chain.

The size, extent of aggregation and relative nativity of protein antigens can all dramatically affect the quality and quantity of antibody produced. Small polypeptides (<10 ku) and non-protein antigens generally need to be conjugated or crosslinked to larger, immunogenic, carrier proteins to increase immunogenicity and provide T cell epitopes. Generally, the larger the immunogenic protein the better. Larger proteins, even in smaller amounts, usually result in better engagement of antigen presenting antigen processing cells for a satisfactory immune response.

Sentrin-specific protease 8 is an enzyme that in humans is encoded by the SENP8 gene. NEDD8 (MIM 603171) is a ubiquitin-like protein that becomes conjugated to the cullin (see CUL1; MIM 603134) subunit of several ubiquitin ligases. This conjugation, called neddylation, is required for optimal ubiquitin ligase activity. NEDD8-specific deneddylases, such as NEDP1, or DEN1, are required to process the NEDD8 propeptide at a C-terminal diglycine motif and to remove NEDD8 from cullins (Gan-Erdene et al.

Free-range systems often use slower-growing breeds of turkey. Free range dairy: In recent years the free range dairy scheme has become more prevalent. Farms supplying milk under the free range dairy brand abide by the pasture promise, meaning the cows will have access to pasture land to graze for a minimum of 180 days and nights a year. There is evidence to suggest that milk from grass contains higher levels of fats such as omega-3 and conjugated linoleic acid (CLA).

Selective enzyme and antibody separation can be achieved with the use of specific end groups that conjugate with the specific compounds. This results in a formation of a polymer-enzyme conjugate which can be reversibly precipitated and dissolved by changing the temperature. Chen and Hoffman used N-Hydroxysuccinimide (NHS) ester functional end group on NIPAAm to conjugate selectively with β-D-glucosidase. They found that the conjugated enzyme could be repeatedly precipitated and dissolved in solution and still maintain sufficient enzymatic activity.

Most fluorophores are organic small molecules of 20 - 100 atoms (200 - 1000 Dalton - the molecular weight may be higher depending on grafted modifications, and conjugated molecules), but there are also much larger natural fluorophores that are proteins: green fluorescent protein (GFP) is 27 kDa and several phycobiliproteins (PE, APC...) are ≈240kDa. Fluorescence particles like quantum dots: 2-10 nm diameter, 100-100,000 atoms, are also considered fluorophores. The size of the fluorophore might sterically hinder the tagged molecule, and affect the fluorescence polarity.

A change in the voltage across the membrane will therefore cause a spectral shift resulting from a direct interaction between the field and the ground and excited state dipole moments. New voltage dyes can sense voltage with high speed and sensitivity using photoinduced electron transfer (PeT) through a conjugated molecular wire. Slow-response probes: These exhibit potential-dependent changes in their transmembrane distribution which are accompanied by a fluoresence change. Typical slow-response probes include cationic carbocyanines and rhodamines, and ionic oxonols.

His efficacy studies of the Haemophilus influenzae type b (Hib) conjugate vaccine in Navajo children resulted in the near-elimination of the virus in North America. He subsequently launched the $37 million GAVI Alliance Hib Initiative, which looked to deploy the conjugated vaccine in developing countries. When the study started, only 20% of countries eligible for support from GAVI had introduced the vaccination. By 2014, over 95% of GAVI eligible countries had introduce the vaccine into their national immunisation programmes.

Once enough PAR has accumulated, it will translocate from the nucleus into the cytosol. One study has suggested that PAR can translocate as a free polymer, however translocation of a protein-conjugated PAR cannot be ruled out and is in fact a topic of active research. PAR moves through the cytosol and enters the mitochondria through depolarization. Within the mitochondria, PAR binds directly to the AIF which has a PAR polymer binding site, causing the AIF to dissociate from the mitochondria.

In addition to viewing the automatically displaying the questions, members of the public can submit their own questions into the system. Their participation shows up on the screens immediately, and is registered by the program. Third Person is the second piece of the ShadowBox series of interactive displays with a built-in computerized tracking system. This piece shows the viewer's shadow, composed hundreds of tiny words that are in fact all the verbs of the dictionary conjugated in the third person.

The quinones are a class of organic compounds that are formally "derived from aromatic compounds [such as benzene or naphthalene] by conversion of an even number of –CH= groups into –C(=O)– groups with any necessary rearrangement of double bonds", resulting in "a fully conjugated cyclic dione structure". The archetypical member of the class is 1,4-benzoquinone or cyclohexadienedione, often called simply "quinone" (thus the name of the class). Other important examples are 1,2-benzoquinone (ortho-quinone), 1,4-naphthoquinone and 9,10-anthraquinone.

To better understand the in vivo stability of peptide conjugated CB-TE2A and Cu-TETA, cross-bridged monoamides were synthesized and tested for their biodistribution. CB-TEAMA, CB-MeTEAMA and CB- PhTEAMA were all produced. Retention in nontarget tissues such as the liver make full characterization of the peptide difficult, so molecules which clear those organs are necessary. The results showed that CB-TE2A did in fact have good biodistribution and in vivo stability as well as all cross-bridged complexes.

17β-Methyl-17α-dihydroequilenin (developmental code name NCI-122), also known as 17β-methyl-6,8-didehydro-17α-estradiol, is a synthetic steroidal estrogen which was never marketed. It is the C17β methylated derivative of 17α-dihydroequilenin, an equine estrogen and constituent of conjugated estrogens (Premarin). 17α-Dihydroequilenin itself is an analogue of 17α-estradiol, the C17 epimer of estradiol (or 17β-estradiol). NCI-122 has respective relative binding affinities of about 8.1% and 16% for the ERα and ERβ when compared to estradiol.

CNBs can engage in cycloaddiiton reactions and easily form the chemical bonds capable of attaching molecules with complex structures. this can be explained by a greater availability of CNB surface to the reactants the presence of π-conjugated structures, and having 5-atom rings with excess pirimidization energy. Formation energy indicated that preparation of CNBs is endothermic, meaning that it is not favorable to create. All CNBs are conducting, regardless of whether the single walled CNT is a metallic or semiconducting base.

French verbs are conjugated by isolating the stem of the verb and adding an ending. In the first and second conjugation, the stem is easily identifiable from the infinitive, and remains essentially constant throughout the paradigm. For example, the stem of ("speak") is parl- and the stem of ("finish") is fin-. In the third group, the relationship between the infinitive form and the stem is less consistent, and several distinct stems are needed to produce all the forms in the paradigm.

For instance, the conjugated form parle can be the 1st or 3rd person singular indicative or subjunctive form of parler, or the singular familiar imperative. Furthermore, the 2nd person singular indicative and subjunctive form parles and the 3rd person plural form parlent are pronounced the same way as parle (except in liaison contexts). The prevalence of syncretism in conjugation paradigms is one functional explanation for the fact that French does not allow null subjects, unlike most of the other Romance languages.

In the second-person plural, modern Spanish speakers in most of Spain employ (masculine) and (feminine) informally and (as the third-person plural) to express respect. In western Andalucia, is used in both contexts, but its verbs are conjugated in the second-person plural. Throughout the Americas and the Canaries, is used in all contexts and in the third person. In peninsular Spain, the use of usted/ustedes has been diminishing in recent decades and may disappear in the near future.

The two components will self-assemble into an interpenetrating network connecting the two electrodes. They are normally composed of a conjugated molecule based donor and fullerene based acceptor. The nanostructural morphology of bulk heterojunctions tends to be difficult to control, but is critical to photovoltaic performance. After the capture of a photon, electrons move to the acceptor domains, then are carried through the device and collected by one electrode, and holes move in the opposite direction and collected at the other side.

17α-Dihydroequilin, or α-dihydroequilin, also known as 7-dehydro-17α-estradiol, as well as estra-1,3,5(10),7-tetraene-3,17α-diol, is a naturally occurring steroidal estrogen found in horses which is closely related to equilin, equilenin, and 17α-estradiol. The compound, as the 3-sulfate ester sodium salt, is present in conjugated estrogens (Premarin), a pharmaceutical extract of the urine of pregnant mares, and is the third highest quantity constituent in the formulation (13.8%). The compound has been studied clinically.

When used to treat menopausal symptoms, the FDA recommends that discontinuation of estradiol should be attempted every three to six months via a gradual dose taper. The combination of bioidentical transdermal or vaginal estradiol and oral or vaginal progesterone appears to be a safer form of hormone therapy than the combination of oral conjugated estrogens and medroxyprogesterone acetate and may not share the same health risks. Advantages may include reduced or no risk of venous thromboembolism, cardiovascular disease, and breast cancer, among others.

This drug was specifically designed to treat brain tumors. Because of the blood brain barrier (BBB), many cancer therapy drugs are prevented from passing through the brain capillaries into the parenchyma. Paclitaxel is generally prevented from reaching its target in the cell due to the presence of the efflux pump P-glycoprotein (P-gp) at the barrier. This is known as a multidrug resistant-associated protein (MRP1) that causes resistance amongst many organic drugs that are not conjugated to acidic ligands.

1,5-Cyclooctadiene A cyclooctadiene (sometimes abbreviated COD) is any of several cyclic diene with the formula (CH2)4(C2H2)2. Focusing only on cis derivatives, four isomers are possible: 1,2-, which is an allene, 1,3-, 1,4-, and 1,5-. Commonly encountered isomers are the conjugated isomer 1,3-cyclooctadiene and 1,5-cyclooctadiene, which is used as a ligand for transition metals. These dienes are colorless volatile liquids.Thomas Schiffer, Georg Oenbrink “Cyclododecatriene, Cyclooctadiene, and 4-Vinylcyclohexene” in Ullmann’s Encyclopedia of Industrial Chemistry, 2005, Wiley-VCH, Weinheim.

Following oral administration, nitazoxanide is rapidly hydrolyzed to the pharmacologically active metabolite, tizoxanide, which is 99% protein bound. Tizoxanide is then glucuronide conjugated into the active metabolite, tizoxanide glucuronide. Peak plasma concentrations of the metabolites tizoxanide and tizoxanide glucuronide are observed 1–4 hours after oral administration of nitazoxanide, whereas nitazoxanide itself is not detected in blood plasma. Roughly of an oral dose of nitazoxanide is excreted as its metabolites in feces, while the remainder of the dose excreted in urine.

Ospemifene was approved on February 26, 2013, for the treatment of moderate to severe dyspareunia, which is a symptom, due to menopause, of vulvar and vaginal atrophy. Combined therapy with conjugated estrogens and the SERM bazedoxifene, was approved on October 3, 2013, for the treatment of vasomotor symptoms linked with menopause. Bazedoxifene is also used in the prevention of postmenopausal osteoporosis. The search for a potent SERM with bone efficacy and better bioavailability than raloxifene led to the discovery of lasofoxifene.

The Affimer protein scaffold has been developed as a biotherapeutic. The small size and stability profile of Affimer proteins combined with their human origin confer drug-like properties to Affimer molecules. This may represent advantages over antibodies in terms of tissue penetration, for example in solid tumours or for non-invasive topical administration, such as inhaled delivery or dermal application. Affimer proteins can be easily conjugated to form multimers and be easily functionalised for the design of therapeutics with specific desired characteristics.

In 2004 he joined the City of Hope National Medical Center, Comprehensive Cancer Center. In 1995, his wife, Mary, was diagnosed with breast cancer and had to go through chemotherapy. Having seen the side effects of cancer treatment, he decided to do research on molecules that would prevent drug from leaking through healthy blood vessels but would stop at the tumor. His group conjugated cyclodextrin to the anti-cancer compound camptothecin to improve the bio-availability and exhibit efficacy in mouse tumor models.

When radioactively labeled 2,4-D was fed to livestock, 90% or more of the total radioactive residue (TRR) was shed in urine unchanged or as conjugated forms of 2,4-D. A relatively small portion of 2,4-D was metabolized into dichlorophenol, dichloroanisole, 4-chlorophenoxyacetic acid (6.9% of the TRR in milk), and 2,4-dichlorophenol (5% of the TRR in milk; 7.3% of the TRR in eggs and 4% of the TRR in chicken liver). Residue levels in kidney were the highest.

The locomotive became operational in 1923 and used parts interchangeable with other Maunsell locomotive classes. The prototype N1 was the only member of the class constructed before the SECR became part of the Southern Railway at the Grouping in 1923, and featured a variant of the Gresley conjugated valve gear designed by Harold Holcroft. The class set the precedent for the Southern Railway's subsequent 3-cylinder designs. The N1s compared favourably with the N class, although the type showed little improvement in performance.

As an approach for photothermal therapy nanobodies binding to the HER2 antigen, which is overexpressed in breast and ovarian cancer cells, were conjugated to branched gold nanoparticles (see figure). Tumor cells were destroyed photothermally using a laser in a test environment. Caplacizumab, a single-domain antibody targeting von Willebrand factor is in clinical trials for the prevention of thrombosis in patients with acute coronary syndrome. A Phase II study examining ALX-0081 in high risk percutaneous coronary intervention has started in September 2009.

The tridecaketide itself contains an alpha-pyrone, a conjugated hexaene, and a single alkenyl moiety. Jaeger and Spiteller suggest that mycenaaurin A might function as a defense compound, since it exhibits antibacterial activity against the Gram-positive bacterium Bacillus pumilus. The chemical is only present in the fruit bodies, and not in the colorless mycelia. An earlier screening for antimicrobial activity in the fruit bodies revealed a weak ability to inhibit the growth of the fungi Candida albicans and Aspergillus fumigatus.

Any active verb can be turned into a passive one by attaching the auxiliary হওয়া to the verbal noun aspect of the verb in question. Only this suffix is conjugated, using the third-person endings for the various tenses. For example: "to eat" is খাওয়া, so "to be eaten" becomes খাওয়া হওয়া; in the future tense, "will be eaten" would be খাওয়া হবে, where হবে is the third-person conjugation for হওয়া in the future tense (more information on tenses below).

Crystal structure of a hexa-tert-butyl-hexa-peri-hexabenzocoronene reported by Müllen and cooworkers in Chem. Eur. J., 2000, 1834-1839. Supramolecular electronics is the experimental field of supramolecular chemistry that bridges the gap between molecular electronics and bulk plastics in the construction of electronic circuitry at the nanoscale 1. In supramolecular electronics, assemblies of pi-conjugated systems on the 5 to 100 nanometer length scale are prepared by molecular self-assembly with the aim to fit these structures between electrodes.

EPM manufacture uses the same monomers as polyethene and polypropene, the ethylene and propylene monomers are randomly combined to yield a rubbery, stable polymer. By varying the monomer ratios and method by which the monomers are combined different forms of EPM can be formed (with a wide range of Mooney viscosities); ranging from amorphous to semi-crystalline. A third, non- conjugated diene monomer can be terpolymerized in a controlled manner to maintain a saturated backbone ready for vulcanization or polymer modification.

The backbone of PIDA is highly conjugated and allows for the formation of an extended pi system along the length of the polymer. This property of PIDA allows it to transport electricity and act as a molecular wire or an organic semiconductor. Considering PIDA's backbone and the fact that Iodine atoms can easily undergo elimination, it is conceivable that PIDA can be subjected to full reductive deiodination in the presence of a Lewis base, such as pyrrolidine to yield carbyne.

Thus conjugated bile acids are almost always in their deprotonated (A-) form in the duodenum, which makes them much more water-soluble and much more able to fulfil their physiologic function of emulsifying fats.'Essentials of Medical Biochemistry, Lieberman, Marks and Smith, eds, p432, 2007' Once secreted into the lumen of the intestine, bile salts are modified by gut bacteria. They are partial dehydroxylated. Their glycine and taurine groups are removed to give the secondary bile acids, deoxycholic acid and lithocholic acid.

It is common for languages to use a reflexive marker to signal the inchoative member of an alternating pair of verbs.Piñón, Christopher. "Modelling the causative-inchoative alternation."Linguistische Arbeitsberichte 76 (2001): 273-293. Inchoative verbs in German are marked either by the reflexive pronoun “sich”, or not marked at all. Shown in examples (14) and (15) is a verb that alternates without any use of a reflexive pronoun: Seen in (14) is the causative use of the verb "zerbrechen", conjugated in past tense.

The specificity of the bond between antibody and antigen has made the antibody an excellent tool for the detection of substances by a variety of diagnostic techniques. Antibodies specific for a desired antigen can be conjugated with an isotopic (radio) or fluorescent label or with a color-forming enzyme in order to detect it. However, the similarity between some antigens can lead to false positives and other errors in such tests by antibodies cross-reacting with antigens that aren't exact matches.

Potassium ferrocyanide is used in a mixture with potassium ferricyanide and phosphate buffered solution to provide a buffer for beta-galactosidase, which is used to cleave X-Gal, giving a bright blue visualization where an antibody (or other molecule), conjugated to Beta-gal, has bonded to its target. On reacting with Fe(3) it gives a Prussian blue colour. Thus it is used as an identifying reagent for iron in labs. Potassium ferrocyanide can be used as a fertilizer for plants.

Aromatic compounds with extended π-conjugated system have attracted attention because of their potential utilization in organic electronics as organic semiconductors. Of academic interest, pentacene has been widely used as an active layer in organic thin film field effect transistors (OFET). The main drawback of pentacene OFET is degradation upon exposure to light and air. On the other hand, [n]phenacenes, an isomeric form of [n]acenes, has been known as a stable compound in which the benzene rings are fused in a zigzag structure.

PTU also acts by inhibiting the enzyme 5'-deiodinase (tetraiodothyronine 5' deiodinase), which converts T4 to the more active form T3. (This is in contrast to methimazole, which shares propylthiouracil's central mechanism, but not its peripheral one.) It is important to recognize that these enzymes only work on the conjugated tyrosine molecules of T3 and T4: a completely different enzyme family is responsible for the deiodinase activity of iodized single tyrosine molecules within the thyroid follicular cells. For information on that enzyme family, see Iodotyrosine deiodinase.

Normal levels of bilirubin in blood are below 1.0 mg/dl (17 µmol/l), while levels over 2–3 mg/dl (34-51 µmol/l) typically result in jaundice. High blood bilirubin is divided into two types - unconjugated bilirubin and conjugated bilirubin. Causes of jaundice vary from nonserious to potentially fatal. High unconjugated bilirubin may be due to excess red blood cell breakdown, large bruises, genetic conditions such as Gilbert's syndrome, not eating for a prolonged period of time, newborn jaundice, or thyroid problems.

These nanoparticles are useful in order to facilitate uptake into the cell, and transfer the genetic information to the nucleus. Another in vivo method for delivery supported by results in mice is the injection of AMOs intravenously. Tail vein injection of AMOs in the mice were shown to be effective. In order for this system to be useful, the AMOs were conjugated with cholesterol for increased uptake into the cell through the membrane and were chemically modified by 2′-OMe phosphoramidites to prevent degradation of the AMOs.

Any verb of either aspect can be conjugated into either the past or present tense, but the future tense is only used with imperfective verbs. Aspect describes the state of the action at the time specified by the tense. The verbs of most aspect pairs differ in one of two ways: by prefix or by suffix. In prefix pairs, the perfective verb has an added prefix—for example, the imperfective psát (to write, to be writing) compared with the perfective napsat (to write down).

Researchers have actively been working to develop safe, effective vaccines to lower the worldwide incidence of E. coli infection. In March 2006, a vaccine eliciting an immune response against the E. coli O157:H7 O-specific polysaccharide conjugated to recombinant exotoxin A of Pseudomonas aeruginosa (O157-rEPA) was reported to be safe in children two to five years old. Previous work had already indicated it was safe for adults. A phase III clinical trial to verify the large-scale efficacy of the treatment is planned.

Doxorubicin (DOX) was conjugated with the tetrahedron and was loaded into MCF-7 breast cancer cells that contained the P-glycoprotein drug efflux pump. The results of the experiment showed the DOX was not being pumped out and apoptosis of the cancer cells was achieved. The tetrahedron without DOX was loaded into cells to test its biocompatibility, and the structure showed no cytotoxicity itself. The DNA tetrahedron was also used as barcode for profiling the subcellular expression and distribution of proteins in cells for diagnostic purposes.

For the reaction to complete, aminotransferases require participation of aldehyde containing coenzyme, pyridoxal-5'-phosphate (PLP), a derivative of Pyridoxine (Vitamin B6). The amino group is accommodated by conversion of this coenzyme to pyridoxamine-5'-phosphate (PMP). PLP is covalently attached to the enzyme via a Schiff Base linkage formed by the condensation of its aldehyde group with the ε-amino group of an enzymatic Lys residue. The Schiff base, which is conjugated to the enzymes pyridinium ring is the focus of the coenzyme activity.

The thought would have been consolidated by the fact that graphite a purely carbon-based material was capable of electric conduction due to its expansive π conjugation system. The organic conductors are however, not as good as metal-based conductors. By late 1970s efforts were made for fabricating polymer-based power transmission lines, light weight motors and novel approaches for achieving superconductivity. Currently massive worldwide efforts for achieving higher power conversion efficiencies in OPVs, better hole carrier mobilities in OFETs in π-conjugated polymer domain are underway.

The pKa of a compound is determined by many aspects, but the most significant is the stability of the conjugate base. This is primarily determined by the ability (or inability) of the conjugated base to stabilize negative charge. One of the most important ways of assessing a conjugate base's ability to distribute negative charge is using resonance. Electron withdrawing groups (which can stabilize the molecule by increasing charge distribution) or electron donating groups (which destabilize by decreasing charge distribution) present on a molecule also determine its pKa.

1,1′-Azobis-1,2,3-triazole is a moderately explosive but comparatively stable chemical compound which contains a long continuous chain of nitrogen atoms, with an unbroken chain of eight nitrogen atoms cyclised into two 1,2,3-triazole rings. It is stable up to 194 °C. The compound exhibits cis–trans isomerism at the central azo group: the trans isomer is more stable and is yellow, while the cis isomer is less stable and is blue. The two rings are aromatic and form a conjugated system with the azo linkage.

Subsequently the problem of flexure and lost motion caused the gear to be removed from the SR Moguls in 1931, to be replaced by a third set of Walschaerts gear, as allowed for in the original design. Holcroft's ideas for conjugated valve gear were incorporated into Maunsell's N1 class, K1 class and U1 class three-cylinder locomotives. Holcroft was involved in trials of the Anderson recompression system between 1930 and 1935. He stayed with the Southern Railway after Maunsell's retirement in 1937 to work with Oliver Bulleid.

Pure Indian Foods is based in Princeton Junction, New Jersey. The company uses cream from free- ranging dairy herds in New Jersey for their products. Additionally, Pure Indian Foods uses non-homogenized milk in the spring and fall when grass grows rapidly to give its products a high amount of fat-soluble vitamins and Conjugated Linoleic Acid (CLA). Pure Indian Foods produces ghee, butter with the milk solids and water removed, in multiple variations including digestive, garlic, herbes de provence, Indian dessert, Italian and Niter Kebbeh.

However, asymmetric induction and selective direct addition (for conjugated carbonyl compounds) can be achieved in the presence of chiral amine bases. (7)File:PhosAddScope3.png The discovery and use of silylated phosphorus reagents in this reaction represented a methodological advance. Selective silyl group transfer occurs in mixed reagents, and cleavage of the resulting silicon-oxygen bonds can often be accomplished hydrolytically, providing access to α-hydroxy derivatives. Alkylation of α-siloxy products provides a convenient route to otherwise difficult to access α-alkoxy phosphorus compounds.

Suh's subspecialty is the imaging for the musculoskeletal diseases and he continued to study on the MR contrast agent (iron oxide nanoparticles) development since 1996 and MR perfusion and molecular imaging. He proved the concept of targeted cancer molecular imaging using high sensitive antibody conjugated magnetic nanoparticle agents. He could improve the sensitivity for the detection of a tumor of very small size and then revealed the possibility of personalized therapy. For this work he was awarded South Korea's highest scientific technical award in 2007.

One important family of pterin derivatives are Folates. Folates are pterins that contain p-aminobenzoic acid connected to the methyl group at position 6 of the pteridine ring system (known as pteroic acid) conjugated with one or more L-glutamates. They participate in numerous biological group transfer reactions. Folate-dependent biosynthetic reactions include the transfer of methyl groups from 5-methyltetrahydrofolate to homocysteine to form L-methionine, and the transfer of formyl groups from 10-formyltetrahydrofolate to L-methionine to form N-formylmethionine in initiator tRNAs.

The modus operandi of SARG04 is based on the principle that the hardware must remain the same (as prior protocols) and the only change must be in the protocol itself. In the original "prepare and measure" version, SARG04's two conjugated bases are chosen with equal probability. Double clicks (when both detectors click) are important for comprehending SARG04: double clicks work differently in BB84 and SARG04. In BB84, their item is discarded because there is no way to tell what bit Alice has sent.

TH (green) in the axons of sympathetic autonomic neurons. Immunocytochemistry (ICC) is a common laboratory technique that is used to anatomically visualize the localization of a specific protein or antigen in cells by use of a specific primary antibody that binds to it. The primary antibody allows visualization of the protein under a fluorescence microscope when it is bound by a secondary antibody that has a conjugated fluorophore. ICC allows researchers to evaluate whether or not cells in a particular sample express the antigen in question.

Sino-Japanese words are almost exclusively nouns, of which many are verbal nouns or adjectival nouns, meaning that they can act as verbs or adjectives. Verbal nouns can be used as verbs by appending (e.g. ), while an adjectival noun uses instead of (usual for nouns) when acting attributively. In Japanese, verbs and adjectives (that is, inflecting adjectives) are closed classes, and despite the large number of borrowings from Chinese, virtually none of these became inflecting verbs or adjectives, instead being conjugated periphrastically as above.

In contrast to organic crystals investigated in the 1960-70s, organic semiconductors that are nowadays used as active media in optoelectronic devices are usually more or less disordered. Combined with the fact that the structural building blocks are held together by comparatively weak van der Waals forces this precludes charge transport in delocalized valence and conduction bands. Instead, charge carriers are localized at molecular entities, e.g. oligomers or segments of a conjugated polymer chain and move by incoherent hopping among adjacent sites with statistically variable energies.

Levels of trazodone are about 10-fold those of mCPP with treatment. The mean blood elimination half-life of trazodone is biphasic: the first phase's half- life is 3 to 6 hours, and the following phase's half-life is 5 to 9 hours. Metabolites are conjugated to gluconic acid or glutathione and around 70 to 75% of 14C-labelled trazodone was found to be excreted in the urine within 72 hours. The remaining drug and its metabolites are excreted in the faeces via biliary elimination.

Labrador Basin is an immense structural trough between Greenland and Labrador that formed as a result of seafloor spreading from the Late Cretaceous to the Late Eocene. Its seabed consists of a slightly southeast trending plain that ranges below sea level. In the southeastern part of the basin are a series of seamounts that gradually decrease in height to the northwest. Geophysical data suggest they are the tops of the buried Mid-Labrador Ridge, which in the southeast is conjugated with the Mid-Atlantic Ridge.

The high electric field at these junctions can split up the excitons, while the single-walled carbon nanotube (SWCNT) can act as a pathway for the electrons. The dispersion of CNTs in a solution of an electron donating conjugated polymer is perhaps the most common strategy to implement CNT materials into OPVs. Generally poly(3-hexylthiophene) (P3HT) or poly(3-octylthiophene) (P3OT) are used for this purpose. These blends are then spin coated onto a transparent conductive electrode with thicknesses that vary from 60 to 120 nm.

The TFT is a special type of MOSFET. Rising costs of materials and manufacturing, as well as public interest in more environmentally friendly electronics materials, have supported development of organic based electronics in more recent years. In 1986, Mitsubishi Electric researchers H. Koezuka, A. Tsumura and Tsuneya Ando reported the first organic field-effect transistor, based on a polymer of thiophene molecules. The thiophene polymer is a type of conjugated polymer that is able to conduct charge, eliminating the need to use expensive metal oxide semiconductors.

Because A. baumannii can survive on dry surfaces up to 20 days, they pose a high risk of spread and contamination in hospitals, potentially putting immunocompromised and other patients at risk for drug-resistant infections that are often fatal and, in general, expensive to treat. Reports suggest this bacterium is susceptible to phage therapy. Gene-silencing antisense oligomers in a form called peptide- conjugated phosphorodiamidate morpholino oligomers have also been reported to inhibit growth in tests carried out in animals infected with antibiotic- resistant A. baumannii.

Sylheti verbs are highly inflected and are regular with only few exceptions. They consist of a stem and an ending; they are traditionally listed in Sylheti dictionaries in their "verbal noun" form, which is usually formed by adding -a to the stem: for instance, ꠇꠞꠣ (xôra, to do) is formed from the stem ꠇꠞ. The stem can end in either a vowel or a consonant. Verbs are conjugated for tense and person by changing the endings, which are largely the same for all verbs.

Johnson has been a leading researcher at Penn since he began working there in 1994. He summarizes his research in his CV, which is available on his website: > My research interests include transport phenomena (charge, energy, and spin) > in nanoscale systems, including carbon nanotubes and graphene, and hybrid > nanostructures based on these materials conjugated with proteins, synthetic > peptides, and DNA. Recent research accomplishments include: Creation of bio- > inspired vapor sensors based on carbon nanotube transistors functionalized > with mammalian olfactory receptors. Crystallographic etching of graphene.

The C5O core of the molecule is planar and conjugated, but the bonds have a definite alternating single- and double- bond nature. The C2–C3 and C4–C5 distances are 1.35 Å, while the C1–C2, C3–C4, C5–C1 are closer to single bonds with distances near 1.50 Å. The phenyl groups of tetraphenylcyclopentadienone adopt a "propeller" shape in its 3D conformation. The four phenyl rings are rotated out of the plane of the central ring because of steric repulsion with each other.

Other possibilities exist, as well. For example, immunohistochemistry usually utilizes an antibody to one or more proteins of interest that are conjugated to enzymes yielding either luminescent or chromogenic signals that can be compared between samples, allowing for localization information. Another applicable technique is cofractionation in sucrose (or other material) gradients using isopycnic centrifugation. While this technique does not prove colocalization of a compartment of known density and the protein of interest, it does increase the likelihood, and is more amenable to large-scale studies.

These conjugated molecules act as accessories in the light harvesting complex. Over 600 carotenoids are known, each with a variety of functional groups that alter their absorption spectrum. Okenone appears to be best adapted to the yellow-green transition (520 nm) of the visible spectrum, capturing light below marine plankton in the ocean. This depth varies based on the community structure of the water column. A survey of microbial blooms found Chromatiaceae anywhere between 1.5m and 24m depth, but more than 75% occurred above 12 meters.

In the past it was used extreme rarely to nobles especially, but its sense extended to other people in the 20th century but not so common and when the communists arrived it took the actual form. As happens with all subject pronouns, is often omitted from sentences, its use being implied by verbs in the second person plural form. The form (originating from – thy lordship) is less distant than and somewhat midway between and . The verb is conjugated, as for , in the second person singular form.

Estradiol should not be used in women who are pregnant or breastfeeding or who have breast cancer, among other contraindications. Estradiol is a naturally occurring and bioidentical estrogen, or an agonist of the estrogen receptor, the biological target of estrogens like endogenous estradiol. Due to its estrogenic activity, estradiol has antigonadotropic effects and can inhibit fertility and suppress sex hormone production in both women and men. Estradiol differs from non- bioidentical estrogens like conjugated estrogens and ethinylestradiol in various ways, with implications for tolerability and safety.

Liver function tests can show a combination of results indicative of bile duct obstruction (raised conjugated bilirubin, γ-glutamyl transpeptidase and alkaline phosphatase levels). CA19-9 (carbohydrate antigen 19.9) is a tumor marker that is frequently elevated in pancreatic cancer. However, it lacks sensitivity and specificity, not least because 5% of people lack the Lewis (a) antigen and cannot produce CA19-9. It has a sensitivity of 80% and specificity of 73% in detecting pancreatic adenocarcinoma, and is used for following known cases rather than diagnosis.

This view has the added advantage that there is a clear correspondence between the Lewis structure of a molecule and the orbitals used to describe its bonding. A conjugated system has a region of overlapping p orbitals, bridging the interjacent locations that simple diagrams illustrate as not having a π bond. They allow a delocalization of π electrons across all the adjacent aligned p orbitals. The π electrons do not belong to a single bond or atom, but rather to a group of atoms.

HRT for the vasomotor symptoms of hypoestrogenism include different forms of estrogen, such as conjugated equine estrogens, 17β-estradiol, transdermal estradiol, ethinyl estradiol, and the estradiol ring. In addition to HRT, there are common progestogens that are used to protect the inner layer of the uterus, the endometrium. These medications include medroxyprogesterone acetate, progesterone, norethisterone acetate, and drospirenone. Non-pharmacological treatment of hot flashes includes using portable fans to lower the room temperature, wearing layered clothing, and avoiding tobacco, spicy food, alcohol and caffeine.

Erich Hückel applied molecular orbital theory to unsaturated hydrocarbon molecules starting in 1931 with his Hückel molecular orbital (HMO) method for the determination of MO energies for pi electrons, which he applied to conjugated and aromatic hydrocarbons.E. Hückel, Zeitschrift für Physik, 70, 204 (1931); 72, 310 (1931); 76, 628 (1932); 83, 632 (1933).Hückel Theory for Organic Chemists, C. A. Coulson, B. O'Leary and R. B. Mallion, Academic Press, 1978. This method provided an explanation of the stability of molecules with six pi-electrons such as benzene.

Swedish still retains two weak verb classes, although only one is productive. In the Romance languages, these developments have also occurred, but to a lesser degree. The classes -āre -ēre -ere -īre remain productive; the fourth (-īre) though is generally only marginally productive. The gradual tendency in all of the daughter languages was to proceed through the stages just described, creating a single conjugational system that applied to all tenses and aspects and allowing all verbs, including secondary verbs, to be conjugated in all inflectional categories.

It has been shown to be relatively safe and well tolerated. It shows no breast or endometrial stimulation and in the first two years, the small increase is better in venous thromboembolism, and similar in the long term to other SERMs. The advantage of bazedoxifene over raloxifene is that it increases endothelial nitric oxide synthase activity and does not antagonize the effect of 17β-estradiol on vasomotor symptoms. The first tissue selective estrogen complex (TSEC) combines conjugated estrogens and the SERM bazedoxifene to blend their activities.

The Streptamer technology allows the reversible isolation and staining of antigen-specific T cells. This technology combines a current T cell isolation method with the Strep-tag technology. In principle, the T cells are separated by establishing a specific interaction between the T cell of interest and a molecule that is conjugated to a marker, which enables the isolation. The reversibility of this interaction and the fact that it is performed at low temperatures is the reason for the successful isolation and characterization of functional T cells.

One of the motivations of Kazhdan–Margulis was to prove the following statement, known at the time as Selberg's hypothesis (recall that a lattice is called uniform if its quotient space is compact): :A lattice in a semisimple Lie group is non- uniform if and only if it contains a unipotent element. This result follows from the more technical version of the Kazhdan–Margulis theorem and the fact that only unipotent elements can be conjugated arbitrarily close (for a given element) to the identity.

Notation: In the morphology section, some notations are used to refer to changes occurring to the morphemes when they are conjugated or combined with one another. 'I' indicates a change whereby the preceding word goes through the following changes: after a vowel (V) of a vowel and glottal stop (V') the root remains the same, so /wepa/ remains /wepa/. After a k or k', the preceding vowel is duplicated, so /banak'/ becomes /banak'a/. In all other cases i is added, so /jaman/ becomes /jamani/.

A phase telescope or Bertrand lens is an optical device used in aligning the various optical components of a light microscope. In particular it allows observation of the back focal plane of the objective lens and its conjugated focal planes. The phase telescope/Bertrand lens is inserted into the microscope in place of an eyepiece to move the intermediate image plane to a point where it can be observed. Phase telescopes are primarily used for aligning the optical components required for Köhler illumination and phase contrast microscopy.

SUMOplot is a tool used to predict sumoylation sites, an important post-translational modification of proteins. SUMO-modified proteins contain the tetrapeptide motif B-K-x-D/E where B is a hydrophobic residue, K is the lysine conjugated to SUMO, x is any amino acid (aa), D or E is an acidic residue. Substrate specificity appears to be derived directly from Ubc9 and the respective substrate motif. SUMOplot predicts the probability for the SUMO consensus sequence (SUMO-CS) to be engaged in SUMO attachment.

The released lysine can now abstract the proton from the Cα and form a quinoid intermediate, which is facilitated by the delocalization of the negative charge over PLP's conjugated p-system. Subsequently, the protonation of Sγ induces Cβ-Sγ bond cleavage, thereby releasing homocysteine The external aldimine is displaced by the nucleophilic attack of the lysine, regenerating the catalytically active internal aldimine and releasing dehydroalanine. Lastly, the enamine tautomerizes into an imine that undergoes hydrolytic deamination to form pyruvate and ammonia. Mechanism catalyzed by cystathionine beta-lyase.

Bengali verbs are highly inflected and are regular with only few exceptions. They consist of a stem and an ending; they are traditionally listed in Bengali dictionaries in their "verbal noun" form, which is usually formed by adding -a to the stem: for instance, করা (kôra, to do) is formed from the stem কর. The stem can end in either a vowel or a consonant. Verbs are conjugated for tense and person by changing the endings, which are largely the same for all verbs.

VTE occurs more frequently in the first year of treatment with estrogens. The risk of VTE is higher with oral non-bioidentical estrogens such as ethinylestradiol and conjugated estrogens than with parenteral formulations of estradiol such as injectable, transdermal, implantable, and intranasal. VTE risk also increases with age and in patients who smoke, so many clinicians advise using the safer estrogen formulations in smokers and patients older than 40. In addition, VTE risk is increased by progestins and increases with the dosages of both estrogens and progestins.

A sincere love is conjugated with the desire for one's people and country to reach towards perfection, and to correct the faults - and therefore to reveal them. And so criticism of a beloved people and country is not rusophobia but a proper patriotism, whereas the desire to hide defects reveals indifference to the people and the country, characteristic of populism and a slavish longing to serve those in power. In his article 'Diagnosis', Klejn details the ongoing process of Nazification of Russia both from above and below.

Conducting polymer metal nanocomposites are. In past years, polymers were known so far as a class of heat sensitive, flexible, electrically insulting amorphous materials. But new dimensions to present era is given by the discovery of π-conjugated conducting polymers commonly such as polyacetylene (PA). Nowadays various conducting polymers such as polyaniline (PANI), polypyrrole (PPy), polyindole, and polythiophenes (see conductive polymer) are most studied and various methods are reported such as hard template methods, soft template methods are used for the synthesis of various nanostructures.

As a result, SUMO-4 isn't processed and conjugated under normal conditions, but is used for modification of proteins under stress-conditions like starvation. During mitosis, SUMO-2/3 localize to centromeres and condensed chromosomes, whereas SUMO-1 localizes to the mitotic spindle and spindle midzone, indicating that SUMO paralogs regulate distinct mitotic processes in mammalian cells. One of the major SUMO conjugation products associated with mitotic chromosomes arose from SUMO-2/3 conjugation of topoisomerase II, which is modified exclusively by SUMO-2/3 during mitosis.

Lilotomab (formerly tetulomab, HH1) is a murine monoclonal antibody against CD37, a glycoprotein which is expressed on the surface of mature human B cells. It was generated at the Norwegian Radium Hospital. As of 2016 it was under development by the Norwegian company Nordic Nanovector ASA as a radioimmunotherapeutic in which lilotomab is conjugated to the beta radiation- emitting isotope lutetium-177 by means of a linker called satetraxetan, a derivative of DOTA. This compound is called 177Lu-HH1 or lutetium (177Lu) lilotomab satetraxetan (trade name Betalutin).

Estriol has significant bioavailability, but its potency is limited by rapid metabolism and excretion and its relatively weak estrogenic activity. With oral administration, during first-pass metabolism, a considerable portion of estriol is conjugated via sulfation into estriol sulfate and rapidly excreted. Only about 10 to 20% of a dose of estriol remains in the circulation, and of this, only about 1 to 2% is present in its active, unconjugated form. Peak levels of estriol occur about 1 to 3 hours after an oral dose.

The pharmacology of estradiol, an estrogen medication and naturally occurring steroid hormone, concerns its pharmacodynamics, pharmacokinetics, and various routes of administration. Estradiol is a naturally occurring and bioidentical estrogen, or an agonist of the estrogen receptor, the biological target of estrogens like endogenous estradiol. Due to its estrogenic activity, estradiol has antigonadotropic effects and can inhibit fertility and suppress sex hormone production in both women and men. Estradiol differs from non- bioidentical estrogens like conjugated estrogens and ethinylestradiol in various ways, with implications for tolerability and safety.

Arglabin is a sesquiterpene lactone belonging to the guaianolide subclass bearing a 5,7,5-tricyclic ring system which is known to inhibit farnesyl transferase. It is characterized by an epoxide on the cycloheptane as well as an exocyclic methylene group that is conjugated with the carbonyl of the lactone. Arglabin is extracted from Artemisia glabella, a species of wormwood, found in the Karaganda Region of Kazakhstan. Arglabin and its derivatives are biologically active and demonstrate promising antitumor activity and cytoxocity against varying tumor cell lines.

IR spectroscopy analysis revealed peaks at 1760 cm−1 corresponding to the carbonyl of a γ-lactone and 1660 cm−1 corresponding to C=C. UV spectroscopy reveals absorption at 204 nm with an ε of 19,800 which is characteristic of an exocyclic methylene that is conjugated with the γ-lactone carbonyl. Mass spectroscopy data showed fragments with m/z of 231 which corresponds to a methyl group attached to an epoxide, 213 (M-CH2-H2O)+, 203 (M-CH3-CO)+, and 185 (M-CH3-H2O-CO)+.

Cyclic voltammetry data has shown that various [1,2-b] IFs, can reversibly accept two electrons with the first reduction occurring at -0.8 V. The parent dione has a first reduction potential of -1.19 V, and halogenated versions reduce around -0.6 V. The fully conjugated version, first postulated by Deuschel in the 1950s, is believed to be even better as an electron carrier when compared to the analogus fullerene. This is believed to be due to a low lying LUMO, which was calculated in the Haley Group at the University of Oregon and corroborated by the Tobe group via crystal structure analysis. Confirmation of these low lying LUMOs wis provided by a tips acetylene appended, on the methyl bridges and the center ring, fully conjugated [1,2-b] IF had a first reduction of -0.62 V. The improvement in reduction potential is linked to the fact that the addition of 2 electrons yields an aromatic molecule with increased stability. However, the addition of the steric bulk required to make the molecule stable, lead to a herringbone crystal packing which is not favorable for electron mobility through the crystal.

This dialect generally preserves intimate or familiar tu, the standard equalizing form você, and the respectful or formal o senhor/a senhora, together with their related possessives, to such an extent that almost all speakers use these forms, according to context. Nevertheless, a minority of educated speakers correctly conjugates all of the tu pronouns formally; otherwise, it is mostly conjugated as você. Standard Portuguese usage has vocês and os senhores/as senhoras as plurals of você and o senhor/a senhora, but the vernacular has also produced new forms with the second-person familiar plural function, such as gente (compare a gente as a possible colloquial variation of nós, "we"/"us", that should be conjugated—but commonly is not—as third-person singular), pessoas, pessoal, [meu] povo, cês (eye dialect for vocês in colloquial pronunciation), and galera (the latter mainly associated with youth slang). It is often said that the gaúcho, nordestino and amazofonia dialects, as well as some sociolects elsewhere, such as that in and around the city of Santos, have preserved tu; but unlike in fluminense, the use of você is very limited, and entirely absent among some speakers, and tu takes its place.

In 2008, Biocon and IATRICa of the United States announced a strategic partnership to co-develop immunoconjugates for targeted immunotherapy of cancers and infectious diseases. The companies are co- developing candidate products based upon IATRICa's technology platform and Biocon's expertise in drug development, biologics manufacturing, and clinical research. The goal of this collaboration is to develop a therapeutic vaccine where the T cell mediated immunity is enhanced and maintained against a tumor which otherwise evades immune responses. Methods of developing, characterising and scaling up of conjugated monoclonal antibody production are being currently studied.

Fluorescence microscope with the filter cube turret above the objective lenses, coupled with a camera. The most recent developments in light microscope largely centre on the rise of fluorescence microscopy in biology. During the last decades of the 20th century, particularly in the post-genomic era, many techniques for fluorescent staining of cellular structures were developed. The main groups of techniques involve targeted chemical staining of particular cell structures, for example, the chemical compound DAPI to label DNA, use of antibodies conjugated to fluorescent reporters, see immunofluorescence, and fluorescent proteins, such as green fluorescent protein.

It is known to be a substrate of CYP3A4. It is thought to be a prodrug of 17α-allyl-19-nortestosterone (3-ketoallylestrenol), which, in accordance, is a known active metabolite of allylestrenol. The biological half-life of allylestrenol has been reported to be "several hours" or, presumably in its active form, reportedly about 10 hours. In the blood, unchanged allylestrenol accounted for 15 to 40% of radioactivity, an unconjugated metabolite accounted for 4 to 10% of radioactivity, and the rest of the radioactivity corresponded to conjugated metabolites.

Barbarella et al. studied the oligomerization of 3-(alkylsulfanyl)thiophenes, and concluded from their quantum mechanical calculations, and considerations of the enhanced stability of the radical cation when delocalized over a planar conjugated oligomer, that a radical cation mechanism analogous to that generally accepted for electrochemical polymerization was more likely. Given the difficulties of studying a system with a heterogeneous, strongly oxidizing catalyst that produces difficult to characterize rigid-rod polymers, the mechanism of oxidative polymerization is by no means decided. The radical cation mechanism is generally accepted.

Under normal circumstances, only a very small amount, if any, of urobilinogen, is excreted in the urine. If the liver's function is impaired or when biliary drainage is blocked, some of the conjugated bilirubin leaks out of the hepatocytes and appears in the urine, turning it dark amber. However, in disorders involving hemolytic anemia, an increased number of red blood cells are broken down, causing an increase in the amount of unconjugated bilirubin in the blood. Because the unconjugated bilirubin is not water-soluble, one will not see an increase in bilirubin in the urine.

The most commonly used conjugate vaccine is the Hib conjugate vaccine. Other pathogens that are combined in a conjugate vaccine to increase an immune response are Streptococcus pneumoniae and Neisseria meningitidis', both of which are conjugated to protein carriers like those used in the Hib conjugate vaccine. Both Streptococcus pneumoniae and Neisseria meningitidis are similar to Hib in that infection can lead to meningitis. As of 2018, the latest conjugate vaccine is typhoid conjugate vaccine which may be more effective and prevents typhoid fever in many children under the age of five years.

Proteins of the OAT family catalyze the Na+-independent facilitated transport of fairly large amphipathic organic anions (and less frequently neutral or cationic drugs), such as bromosulfobromophthalein, prostaglandins, conjugated and unconjugated bile acids (taurocholate and cholate), steroid conjugates, thyroid hormones, anionic oligopeptides, drugs, toxins and other xenobiotics. One family member, OATP2B1, has been shown to use cytoplasmic glutamate as the exchanging anion. Among the well characterized substrates are numerous drugs including statins, angiotensin-converting enzyme inhibitors, angiotensin receptor blockers, antibiotics, antihistaminics, antihypertensives and anticancer drugs. Other substrates include luciferin, thyroid hormones and quinolones.

All versions of the RKM incorporate a working chamber formed by smoothly conjugated circular arcs. The piston, shaped to conform to the chamber's walls, "jumps" from wall to wall, thus performing a rotary motion. The piston has an appropriately shaped aperture fitted with a gear structure, and this drives the power shaft (or two power shafts in some models). The piston, its aperture and the working chamber of the RKMs represent, in their cross sections, multi-oval figures which, mathematically, are related to the class of figures of equal width.

In Hückel theory, a Dewar reactivity number, also known as Dewar number, is a measure of the reactivity in aromatic systems. It is used to quantify the difference in energy between the π-system of the original molecule and the intermediate having the incoming electrophile or nucleophile attached. It can be used to study important transformations such as the nitration of conjugated systems from a theoretical perspective. The change in energy during the reaction can be derived by allowing the orbitals nearby the site i of attack to interact with the incoming molecule.

The presence of the long chromophore of conjugated double bonds (polyene chain) provides the distinctive light-absorbing properties. The polyene chain is susceptible to oxidative degradation by light or heat and is chemically unstable in acids. Lutein is present in plants as fatty-acid esters, with one or two fatty acids bound to the two hydroxyl-groups. For this reason, saponification (de-esterfication) of lutein esters to yield free lutein may yield lutein in any ratio from 1:1 to 1:2 molar ratio with the saponifying fatty acid.

Relaxase also unwinds the plasmid being conjugated with its helicase properties. The relaxosome interacts with integration host factors within the oriT. Other genes that code for relaxosome components include TraH, which stabilizes the relaxosome's structural formation, TraI, which encodes for the relaxase protein, TraJ, which recruits the complex to the oriT site, TraK, which increases the 'nicked' state of the target plasmid, and TraY, which imparts single-stranded DNA character on the oriT site. TraM plays a particularly important role in relaxase interaction by stimulating 'relaxed' DNA formation.

The most common materials are photorefractive crystals, but in semiconductors or semiconductor heterostructures (such as quantum wells), atomic vapors and gases, plasmas and even liquids, it was possible to generate holograms. A particularly promising application is optical phase conjugation. It allows the removal of the wavefront distortions a light beam receives when passing through an aberrating medium, by sending it back through the same aberrating medium with a conjugated phase. This is useful, for example, in free-space optical communications to compensate for atmospheric turbulence (the phenomenon that gives rise to the twinkling of starlight).

Parkin is a 465-residue E3 ubiquitin ligase that plays a critical role in ubiquitination- the process whereby molecules are covalently labelled with ubiquitin (Ub) and directed towards degradation in proteasomes or lysosomes. Ubiquitination involves the sequential action of three enzymes. First, an E1 ubiquitin-activating enzyme binds to inactive Ub in eukaryotic cells via a thioester bond and mobilises it in an ATP-dependent process. Ub is then transferred to an E2 ubiquitin-conjugating enzyme before being conjugated to the target protein via an E3 ubiquitin ligase.

In this case, a concerted mechanism in which the bond to the oxygen is simultaneously broken with metal-center while it is formed with the substrate is probable. However, more recent studies have indicated a radical intermediate is possible, challenging the assumption that non-conjugated alkenes undergo concerted mechanisms. In the original catalytic reaction, iodosylarenes (PhIO) were used as the stoichiometric oxidant, but soon after it was found that chlorine bleach (NaClO), a cheaper alternative, works as well. While other oxidants subsequently have been used, bleach continues to be the most common.

The international trade in food is standardized in the Codex Alimentarius. Hydrogenated oils and fats come under the scope of Codex Stan 19. Non-dairy fat spreads are covered by Codex Stan 256-2007.Codex Stan 256–2007 "Standard for Fat Spreads and Blended Spreads" (PDF file) In the Codex Alimentarius, trans fat to be labelled as such is defined as the geometrical isomers of monounsaturated and polyunsaturated fatty acids having non-conjugated [interrupted by at least one methylene group (−CH2−)] carbon-carbon double bonds in the trans configuration.

A NZR G class Garratt locomotive Beyer, Peacock built three NZR G class locomotives in 1928, which were too powerful for the system and had complicated valve mechanisms. Unusually, these engines had three cylinders (24×16.5 in) each, on two sets of engine frames, thus creating a six-cylinder Garratt; they were the second and final Garratts to employ this arrangement, the other being the one-off LNER U1. They entered service in 1929. Walschaerts valve gear operated the outside cylinders with the inner third cylinder linked by a Gresley conjugated valve gear.

Cyclic rearrangements include cycloadditions and, more generally, pericyclic reactions, wherein two or more double bond-containing molecules form a cyclic molecule. An important example of cycloaddition reaction is the Diels–Alder reaction (the so-called [4+2] cycloaddition) between a conjugated diene and a substituted alkene to form a substituted cyclohexene system. Whether a certain cycloaddition would proceed depends on the electronic orbitals of the participating species, as only orbitals with the same sign of wave function will overlap and interact constructively to form new bonds. Cycloaddition is usually assisted by light or heat.

When administered orally, ketamine undergoes first- pass metabolism, where it is biotransformed in the liver by CYP3A4 (major), CYP2B6 (minor), and CYP2C9 (minor) isoenzymes into norketamine (through N-demethylation) and ultimately dehydronorketamine. Intermediate in the biotransformation of norketamine into dehydronorketamine is the hydroxylation of norketamine into hydroxynorketamine by CYP2B6 and CYP2A6. As the major metabolite of ketamine, norketamine is one-third to one-fifth as potent as an anesthetic, and plasma levels of this metabolite are three times higher than ketamine following oral administration. Ketamine and its metabolites are also conjugated.

Stercobilin results from breakdown of the heme moiety of hemoglobin found in erythrocytes. Macrophages break down senescent erythrocytes and break the heme down into biliverdin, which rapidly reduces to free bilirubin. Bilirubin binds tightly to plasma proteins (especially albumin) in the blood stream and is transported to the liver, where it is conjugated with one or two glucuronic acid residues into bilirubin diglucuronide, and secreted into the small intestine as bile. In the small intestine, some bilirubin glucuronide is converted back to bilirubin via bacterial enzymes in the terminal ileum.

Members of the UBL family are small, non-enzymatic proteins that share a common structure exemplified by ubiquitin, which has 76 amino acid residues arranged into a "beta-grasp" protein fold consisting of a five- strand antiparallel beta sheet surrounding an alpha helix. The beta-grasp fold is widely distributed in other proteins of both eukaryotic and prokaryotic origin. Collectively, ubiquitin and ubiquitin-like proteins are sometimes referred to as "ubiquitons". UBLs can be divided into two categories depending on their ability to be covalently conjugated to other molecules.

SUMO proteins have the widest variety of cellular protein targets after ubiquitin and are involved in processes including transcription, DNA repair, and the cellular stress response. NEDD8 is best known for its role in regulating cullin proteins, which in turn regulate ubiquitin-mediated protein degradation, though it likely also has other functions. Two UBLs, ATG8 and ATG12, are involved in the process of autophagy; both are unusual in that ATG12 has only two known protein substrates and ATG8 is conjugated not to a protein but to a phospholipid, phosphatidylethanolamine.

The English language allows a wide variety of expressions of combinations of tense, aspect, and mood, with a variety of grammatical constructions. These constructions involve pure morphological changes (suffixes and internal sound changes of the verb), conjugated compound verbs, and invariant auxiliaries. For English from the perspective of modality, see Palmer; and NielsenNielsen, Niels-Davidsen, Tense and Mood in English: A Comparison With Danish (Topics in English Linguistics), de Gruyter Mouton, 1990. for English from the perspective of tense, see Comrie and Fleischman;Fleischman, Suzanne, The Future in Thought and Action, Cambridge Univ.

In a dictionary, Latin verbs are listed with four "principal parts" (or fewer for deponent and defective verbs), which allow the student to deduce the other conjugated forms of the verbs. These are: # the first person singular of the present indicative active # the present infinitive active # the first person singular of the perfect indicative active # the supine or, in some grammars, the perfect passive participle, which uses the same stem. (Texts that list the perfect passive participle use the future active participle for intransitive verbs.) Some verbs lack this principal part altogether.

A subfamily of stress proteins facilitates translocation of secretory and mitochondrial precursor polypeptides. Nature 332, 800-805 This was the first specific, genetically- and biochemically-validated function to be discovered for a member of the Hsp70 family of proteins. SCF and cullin–RING ubiquitin ligases: As a postdoctoral fellow working with Dr. Marc Kirschner at the University of California, San Francisco, Deshaies discovered a biochemical function for the ubiquitin-conjugated enzyme CDC34, which he showed mediates conjugation of ubiquitin onto G1 cyclin proteins in yeast cells.Deshaies, R.J., Chau, V., and Kirschner, M.W. (1995).

There are different metabolizing pathways for methacrylonitrile, that are elaborated here: First of all, methacrylonitrile can be directly conjugated with GSH, which leads to the formation of S-(2-cyanopropyl) GSH, which can be metabolized to N-acetyl-S- (2-cyanopropyl) cysteine (NACPC), which can be excreted in the urine. Due to this, glutathione is depleted to certain degrees after MeAN exposure. After oral exposure to 100 mg/kg MeAN in rats, the maximum depletion was noticed in the liver at 39% of control. This depletion, however, is less than found after AN administration.

R = OH (aspartic acid), boletocrocin A; R = NH2 (asparagine), boletocrocin B. Boletocrocin is any one of a group of seven closely related organic compounds, individually named boletocrocin A through boletrocrocin G. These compounds are polyene dicarboxylic acids that include both lipophilic and polar amino acids. They were extracted from the brightly colored mushrooms Boletus laetissimus and B. rufoaureus. The boletocrocins' conjugated systems account for the intense color. Related biological pigments are present in other fungi, such as calostomal (from Calostoma cinnabarinum), melanocrocin (from Melanogaster broomeianus), and mycenaaruin A (from Mycena aurantiomarginata).

The commercial version of Racter could be likened to a computerized version of Mad Libs, the game in which you fill in the blanks in advance and then plug them into a text template to produce a surrealistic tale. The commercial program attempted to parse text inputs, identifying significant nouns and verbs, which it would then regurgitate to create "conversations", plugging the input from the user into phrase templates which it then combined, along with modules that conjugated English verbs.Chamberlain, Bill, Getting a Computer to Write About Itself, Atari Archives, accessed Aug. 17, 2007.

It was later extended to conjugated molecules such as pyridine, pyrrole and furan that contain atoms other than carbon, known in this context as heteroatoms.Andrew Streitwieser, Molecular Orbital Theory for Organic Chemists, Wiley, New York (1961). A more dramatic extension of the method to include σ-electrons, known as the extended Hückel method (EHM), was developed by Roald Hoffmann. The extended Hückel method gives some degree of quantitative accuracy for organic molecules in general (not just planar systems) and was used to provide computational justification for the Woodward–Hoffmann rules.

Quantification with PBA can be achieved by measuring intensity of the red color from phenolphthalein because brighter red emerges when the sample contains higher concentration of target antigens. For instance, if more antigens are bound to the surface antibodies, more eosin-conjugated antibodies will also bind to the bound analytes. Thus, photopolymerization on the surface becomes much faster and forms a thicker hydrogel film in which phenolphthalein molecules are trapped. Since more phenolphthalein molecules can remain in the thicker film after further rinsing, the indicators can give a higher intensity of red.

Hemotech was developed by HemoBiotech and was a chemically modified haemoglobin. Somatogen developed a genetically engineered and crosslinked tetramer it called Optro. It failed in a phase II trial that was published in 2014 and development was halted. A pyridoxylated Hb conjugated with polyoxyethylene was created by scientists at Ajinomoto and eventually developed by Apex Biosciences, a subsidiary of Curacyte AG; it was called "PHP" and failed in a Phase III trial published in 2014, due to increased mortality in the control arm, which led to Curacyte shutting down.

Diagram showing which verbs (apart from les verbes pronominaux) are conjugated with être; below each verb in infinitive form is the past participle. The passé composé (, compound past) is the most used past tense in the modern French language. It is used to express an action that has been finished completely or incompletely at the time of speech, or at some (possibly unknown) time in the past. The passé composé originally corresponded in function to the English present perfect, but is now used mainly as the equivalent of the simple past.

The Blue Ridge Rangers Rides Again is the eighth solo studio album by American roots rock singer-songwriter and guitarist John Fogerty, first released on September 1, 2009, on Fogerty's own label, Fortunate Son Records and distributed by Verve Forecast Records. The apparent grammatical error in the title of the album (the verb should be conjugated 'ride,' not 'rides') is a play on the fact that the original Blue Ridge Rangers (on the 1973 album The Blue Ridge Rangers) consisted entirely of Fogerty singing all the vocals and playing all the instruments by himself.

Happy Cow Creamery milk is not homogenized and is pasteurized with a low-temperature "batch pasteurization" process that is reported to kill harmful bacteria while preserving vitamins and helpful enzymes. The dairy is inspected by the State of South Carolina. The milk is not raw, although raw milk is legal to sell in South Carolina from the farm or small stores. Meat and dairy products from grass-fed animals can produce 300-500% more conjugated linoleic acid (CLA) than those of cattle fed the usual diet of 50% hay and silage, and 50% grain.

We can also see how changes in the distribution of these genes can affect the development of a tissue, and correlate it with behavioral manipulations. Some examples are the use of, digoxigenin- or fluorophore-conjugated oligo- nucleotide probes, for the detection of localized mRNAs in dendrites, spines, axons, and growth cones of cultured neurons; or digoxigenin-labeled RNA probes and fluorescence tyramide amplification for the detection of less abundant mRNAs localized to dendrites in vivo. These examples use FISH (Fluorescent in situ hybridization). With this technique we can understand the physiological processes and neurological diseases.

The third cylinder and Gresley gear are visible below the smokebox of this 4-12-2. Gresley conjugated valve gear was used by the American Locomotive Company under license for the 4-12-2 locomotives built for the Union Pacific Railroad between 1926 and 1930. These were the largest locomotives to use this valve gear. It was also used in Australia for the Victorian Railways S class 4-6-2 of 1928AHRS Railway Museum History: 1900 - 1950 retrieved 1 October 2006 and New South Wales Government Railways D57 class 4-8-2 of 1929.australiansteam.

The lipids' unsaturations are generally conjugated (as opposed to the unconjugation found in Bacteria and Eukaryota). In Thermosphaera, as in all members of the Crenarchaeota, the membranes are predominated by the 40-carbon lipids that span the entire membrane. This causes the membrane to be composed of monolayers with polar groups at each end. The cells are rod-shaped with diameters of up to 4 micrometres and up to 100 micrometres in length, and reproduce by developing branches on the end of the cell which grow into individual cells.

Microwave irradiating a mixture of aqueous SWCNT solution and C60 solution in toluene was the first step in making these polymer-SWCNT composites. Conjugated polymer P3HT was then added resulting in a power conversion efficiency of 0.57% under simulated solar irradiation (95 mW/cm2). It was concluded that improved short circuit current density was a direct result of the addition of SWCNTs into the composite causing faster electron transport via the network of SWCNTs. It was also concluded that the morphology change led to an improved fill factor.

OFETs adopt the architecture of TFT. With the development of the conducting polymer, the semiconducting properties of small conjugated molecules have been recognized. The interest in OFETs has grown enormously in the past ten years. The reasons for this surge of interest are manifold. The performance of OFETs, which can compete with that of amorphous silicon (a-Si) TFTs with field-effect mobilities of 0.5–1 cm2 V−1 s−1 and ON/OFF current ratios (which indicate the ability of the device to shut down) of 106–108, has improved significantly.

In cells that express LTC4 synthase, such as mast cells and eosinophils, LTA4 is conjugated with the tripeptide glutathione to form the first of the cysteinyl-leukotrienes, LTC4. Outside the cell, LTC4 can be converted by ubiquitous enzymes to form successively LTD4 and LTE4, which retain biological activity. The cysteinyl-leukotrienes act at their cell-surface receptors CysLT1 and CysLT2 on target cells to contract bronchial and vascular smooth muscle, to increase permeability of small blood vessels, to enhance secretion of mucus in the airway and gut, and to recruit leukocytes to sites of inflammation.

More recently, based on recent findings showing that by-product formation most likely occurs exclusively from the lowest singlet excited state,D. Mendive-Tapia, A. Perrier, M. J. Bearpark, M. A. Robb, B. Lasorne, D. Jacquemin, Phys. Chem. Chem. Phys. 16:18463-18471 (2014) M. Herder, B. Schmidt, L. Grubert, M. Pätzel, J. Schwarz, S. Hecht, J. Am. Chem. Soc. 137 (7):2738–2747 (2015) a superior fatigue resistance of dithienylethenes upon visible-light excitation has been achieved by attaching small triplet- sensitizing moieties to the diarylethene core via a -conjugated linkage.

Cyclodextrins have a toroidal shape, which allows them to have a cavity inside which can fit other molecules. This useful structure allows them to act as drug carriers in the body, as long as the compounds to be delivered have compatible geometry and polarity with the cavity. To determine when these compounds are delivered, the structure of the cyclodextrin nanosponge can be modified to release its contents sooner or later. Several ligands can be conjugated on the surface of the nanosponge to determine where it will target in the body.

Kupffer cells can produce inflammatory cytokines, TNF-alpha, oxygen radicals, and proteases as well as performing phagocytosis. Creating these mediators is believed to lead to the development of liver injury. Apart from clearing any bacteria, red blood cells are also broken down by phagocytic action, where the hemoglobin molecule is split. The globin chains are re-used, while the iron-containing portion, heme, is further broken down into iron, which is re-used, and bilirubin, which is conjugated to glucuronic acid within hepatocytes and secreted into the bile.

The reaction might be disturbed at higher pH values, interfering with other compounds. Space filling model Rosocyanine is formed as a 2:1 complex from curcumin and boric acid in acidic solutions. The boron complexes formed with rosocyanine are dioxaborines (here a 1,3,2-dioxaborine). Curcumin possesses a 1,3-diketone structure and can therefore be considered as a chelating agent. Unlike the simpler 1,3-diketone-containing compound acetylacetone (which forms acetylacetonate complexes with metals), the entire skeleton of curcumin is in resonance with the 1,3-dicarbonyl section, making the backbone an extended conjugated system.

Next, the cinnamic acid is transformed into cinnamoyl CoA which is again converted to either cinnamoylglycine by N-acyl transferase or to benzoyl CoA through β-oxidation, the latter being the major route. Intermediate metabolites in the β-oxidation pathway can be converted to 3-hydroxy-3-phenylpropionic acid and acetophenone, which can be excreted via the urine. However, the conversions of these intermediate metabolites are minor routes. Finally, the benzoyl CoA is conjugated with glycine under formation of hippuric acid or it is hydrolyzed generating free benzoic acid.

It is formed when triplet oxygen, the normal ground state, reacts with sensitizers, such as certain dyes and ketones, excited by radiation to their triplet states. Oxygen also increases the amount of solar radiation absorbed by conjugated unsaturated hydrocarbons through formation of a complex with these materials. The extent of photochemical reactions involving oxygen differ in the inner and outer layers of both aromatic and aliphatic polymers due to their dependence on the diffusion of oxygen through the polymer. Photooxidation is significantly reduced at depths beyond which oxygen penetrates.

Cheryl Forberg began her career with a three-year post as a chef for several Bay Area, California restaurants including Wolfgang Puck’s Postrio Restaurant in San Francisco. She went on to become the private chef for filmmaker George Lucas and his family. Forberg studied the effects of conjugated linoleic acid on lean body mass at USDA Center for Human Nutrition in San Francisco, after which she became the Research Dietician for Cedars Sinai Hospital in Los Angeles, California, the Health Editor for Cooking.com, and recipe development for the UCLA Department of Clinical Nutrition.

Equilin is a naturally occurring estrogen sex hormone found in horses as well as a medication. It is one of the estrogens present in the estrogen mixtures known as conjugated estrogens (CEEs; brand name Premarin) and esterified estrogens (EEs; Estratab, Menest). CEEs is the most commonly used form of estrogen in hormone replacement therapy (HRT) for menopausal symptoms in the United States. Estrone sulfate is the major estrogen in CEEs (about 50%) while equilin sulfate is the second major estrogen in the formulation, present as about 25% of the total.

Cycloparaphenylenes have shown affinity to fullerenes and other carbonaceous molecules, with interactions similar to those in carbon peapods. Potential applications of these structures include nanolasers, single electron transistors, spin-qubit arrays for quantum computing, nanopipettes, and data storage devices. Specifically, the π-π interactions and the concave interior of the cycloparaphenylenes is expected to bind to π conjugated systems with convex surfaces that can fit inside the ring. Indeed, [10]CPP has been shown to selectively bind a C60 fullerene within its hole, thus producing a "molecular bearing".

Baulieu has had an ongoing interest in dehydroepiandrosterone (DHEA). In 1960 he demonstrated that DHEA was the main adrenal androgen, was largely conjugated as a hydrophilic sulfate, and described its metabolism and functions. He worked to uncover the production of estrogens by the placenta during pregnancy and this led to the concept of DHEA being a "prohormone". Upon the invitation of Seymour Lieberman Baulieu became visiting scientist at the Columbia University in 1961-1962, and during this time he met Gregory Pincus, the father of the "birth control pill".

Therefore, many push-pull olefins exhibit high TPA transitions, up to several thousand GM. It is also found that compounds with a real intermediate energy level close to the "virtual" energy level can have large 2-photon cross- sections as a result of resonance enhancement. There are several databases of two-photon absorption spectra available online. Compounds with interesting TPA properties also include various porphyrin derivatives, conjugated polymers and even dendrimers. In one study a diradical resonance contribution for the compound depicted below was also linked to efficient TPA.

The contributions of these metabolites to the psychoactive and toxic effects of MDMA are an area of active research. 80% of MDMA is metabolised in the liver, and about 20% is excreted unchanged in the urine. MDMA is known to be metabolized by two main metabolic pathways: (1) O-demethylenation followed by catechol-O-methyltransferase (COMT)-catalyzed methylation and/or glucuronide/sulfate conjugation; and (2) N-dealkylation, deamination, and oxidation to the corresponding benzoic acid derivatives conjugated with glycine. The metabolism may be primarily by cytochrome P450 (CYP450) enzymes CYP2D6 and CYP3A4 and COMT.

Dalfopristin is synthesized from pristinamycine IIa through achieving a stereoselective Michael-type addition of 2-diethylaminoethanethiol on the conjugated double bond of the dehydroproline ring . The first method found was using sodium periodate associated with ruthenium dioxide to directly oxidize the sulfur derivative into a sulfone. However, using hydrogen peroxide with sodium tungstate in a 2-phase medium produces an improved yield, and is therefore the method of choice for large scale production. The production of the dalfopristin portion of quinupristin/dalfopristin is achieved through purifying cocrystallization of the quinupristin and dalfopristin from acetone solutions.

Most of the masculine and feminine nouns were later grouped together into a common gender. The verb system was also more complex: it included subjunctive and imperative moods and verbs were conjugated according to person as well as number. By the 16th century, the case and gender systems of the colloquial spoken language and the profane literature had been largely reduced to the two cases and two genders of modern Swedish. The old inflections remained common in high prose style until the 18th century, and in some dialects into the early 20th century.

Other ligands or combinations thereof may result in distinct mechanisms during cancer metastasis. Beyond a direct interaction with tumor cells, E-selectin induction in response to cytokines locally secreted by cancer cells enables specific tumor targeting of sLeX-conjugated nanoparticles or thioaptamers containing anti-tumor payloads. In addition, E-selectin may also function to recruit monocytes to primary tumors or lung metastases to promote an inflammatory pro- tumor microenvironment. Blocking these interactions or enabling trafficking of CAR-T cells to E-selectin-positive sites may hold promise for future therapeutic development.

Reproduction is authorized provided the source is acknowledged. On February 2010, Prevnar 13 was approved in the United States to replace the pneumococcal 7-valent conjugate vaccine. After waiting for the outcome of a trial underway in the Netherlands, the Centers for Disease Control and Prevention (CDC) recommended the vaccine for adults over age 65 in August 2014. Prevnar (PCV7) was a heptavalent vaccine, meaning that it contains the cell capsule sugars of seven serotypes of the bacteria S. pneumoniae (4, 6B, 9V, 14, 18C, 19F, and 23F), conjugated with diphtheria proteins.

To specifically target tumor cells, the polyethylenegylated gold particles are conjugated with an antibody (or an antibody fragment such as scFv), against, e.g. epidermal growth factor receptor, which is sometimes overexpressed in cells of certain cancer types. Using SERS, these pegylated gold nanoparticles can then detect the location of the tumor. Gold nanoparticles accumulate in tumors, due to the leakiness of tumor vasculature, and can be used as contrast agents for enhanced imaging in a time-resolved optical tomography system using short-pulse lasers for skin cancer detection in mouse model.

These AuNPs were found to be toxic in mouse liver by injection, causing cell death and minor inflammation. However, AuNPs conjugated with PEG copolymers showed negligible toxicity towards human colon cells (Caco-2). AuNP toxicity also depends on the overall charge of the ligands. In certain doses, AuNSs that have positively-charged ligands are toxic in monkey kidney cells (Cos-1), human red blood cells, and E. coli because of the AuNSs interaction with the negatively-charged cell membrane; AuNSs with negatively-charged ligands have been found to be nontoxic in these species.

Bosseopentaenoic acid (BPA) is a conjugated polyunsaturated fatty acid. Bosseopentaenoic acid can be extracted from the red coralline algae, Bossiella orbigniana. The first total synthesis of methyl bosseopentaenoate by consecutive palladium-catalyzed reactions was reported in 2011. In 2017, bosseopentaenoic acid was obtained from the ester hydrolysis of methyl bosseopentaenoate in good yield using mild condition and the synthesis of its sulfur-bridged analogue of BPA; thiophene analogue was achieved by Mohamed and Solum In this study, a comparison between the thiophene analogue and BPA with respect to their antioxidant activity was accomplished.

Acyclic aliphatic/non-aromatic compound (butane) Cyclic aliphatic/non-aromatic compound (cyclobutane) In organic chemistry, hydrocarbons (compounds composed solely of carbon and hydrogen) are divided into two classes: aromatic compounds and aliphatic compounds (; G. aleiphar, fat, oil), also known as non-aromatic hydrocarbons. Aliphatics can be cyclic; however, hydrocarbons with conjugated pi-systems that obey Hückel's rule are instead considered to be aromatic. Aliphatic compounds can be saturated, like hexane, or unsaturated, like hexene and hexyne. Open-chain compounds (whether straight or branched) contain no rings of any type, and are thus aliphatic.

There are two methods involved in immunolabeling, the direct and the indirect methods. In the direct method of immunolabeling, the primary antibody is conjugated directly to the tag. The direct method is useful in minimizing cross-reaction, a measure of nonspecificity that is inherent in all antibodies and that is multiplied with each additional antibody used to detect an antigen. However, the direct method is far less practical than the indirect method, and is not commonly used in laboratories, since the primary antibodies must be covalently labeled, which require an abundant supply of purified antibody.

First, two-step protocols are often used to avoid the cross-reaction between the immunolabeling of multiple primary and secondary antibody mixtures, where secondary fragment antigen-binding antibodies are frequently used. Secondly, haptenylated primary antibodies can be used, where the secondary antibody can recognize the associated hapten. The hapten is covalently linked to the primary antibody by succinyl imidesters or conjugated IgG Fc-specific Fab sections. Lastly, primary monoclonal antibodies that have different Ig isotypes can be detected by specific secondary antibodies that are against the isotype of interest.

Magnetic immunoassay (MIA) is a novel type of diagnostic immunoassay utilizing magnetic nanobeads as labels in lieu of conventional, enzymes, radioisotopes or fluorescent moieties. This assay involves the specific binding of an antibody to its antigen, where a magnetic label is conjugated to one element of the pair. The presence of magnetic nanobeads is then detected by a magnetic reader (magnetometer) which measures the magnetic field change induced by the beads. The signal measured by the magnetometer is proportional to the analyte (virus, toxin, bacteria, cardiac marker, etc.) quantity in the initial sample.

A further application of streptavidin is for purification and detection of proteins genetically modified with the Strep-tag peptide. Streptavidin is widely used in Western blotting and immunoassays conjugated to some reporter molecule, such as horseradish peroxidase. Streptavidin has also been used in the developing field of Nanobiotechnology, the use of biological molecules such as proteins or lipids to create nanoscale devices/structures. In this context streptavidin can be used as a building block to link biotinylated DNA molecules to create single walled carbon nanotube scaffolds or even complex DNA polyhedra.

Affinity therapy, or immunotoxins is a biorecognition-based approach to selectively deliver a cytotoxic drug or toxin to a specific target cell. The field of affinity therapy was pioneered by Wilchek, together with Michael Sela, Ester Hurwitz, and Ruth Arnon. In 1975, they applied drug-conjugated antibodies for the targeted delivery of cytotoxic compounds to cancer cells. They also demonstrated the advantage of having a polymeric spacer between the antibody and the drug and showed the effectiveness of conjugating simple polymers such as dextran for drug delivery and targeting.

Tour was the first to show that Feringa-based motors can be used to move a molecule on a surface using light as opposed to electric current from an STM tip. His early career focused upon the synthesis of conjugated polymers and precise oligomers. Tour has also been involved in scientific outreach, such as NanoKids, an interactive learning DVD to teach children fundamentals of chemistry and physics. He also developed SciRave, a Dance Dance Revolution and Guitar Hero package to teach science concepts to middle school and elementary school students.

Both languages have a construction similar to the English "going- to" future. Spanish includes the preposition a between the conjugated form of ir "to go" and the infinitive: Vamos a cantar "We're going to sing" or "Let's sing" (present tense of ir + a + infinitive). Usually, in Portuguese, there is no preposition between the helping verb and the main verb: Vamos cantar (present tense of ir + infinitive). This also applies when the verb is in other tenses: : Ayer yo iba a leer el libro, pero no tuve la oportunidad.

This now- trivalent position is a planar carbocation that is resonance stabilized, interconnecting the π systems of the aromatic rings and the amino functional groups. This single large conjugated system is a chromophore with strong absorption in visible spectrum, giving this compound its distinctive color. This chemical is usually drawn in the resonance structure with the cation on nitrogen. :Transformation between leuco and colored form of crystal violet lactone, halochromism It was the first dye used in carbonless copy papers, and it is still widely used in this application.

Neither word should be confused with subject pronouns which follow the verb in Welsh). More commonly Welsh uses a construction with "Mynd" (to go) "Rwy'n mynd i weld y ffilm yfory" (I'm going to see the film tomorrow) Futurity can also be expressed by using words that imply future action Dwi'n mynd yna heddiw: I am going there today. The simple future, which uses verb suffixes conjugated with the verb, is used to express determination of action or to emphasise confidence in outcome. As in the future of bod, the affirmative marker is fe.

CMPs have been investigated for several applications since their discovery. Surface areas in CMPs can exceed 1000 m2/g in many cases, although related porous aromatic frameworks, which lack extended conjugation, can have much higher surface areas of more than 5500 m2/g. The porosity of these materials has led to their evaluation as sorbents. Recent work has focused on their potential in terms of catalysis, for example in the form of 'metal-organic CMPs', and also for light harvesting, and supercapacitors taking advantage of their highly conjugated nature.

C) The DIBAC-hIgG and azide-hGH conjugates are joined by Cu-free click chemistry to protein trimers; X and Y are PEG-based linkers of different length. The Western blots were first stained with Ponceau and then incubated with IgG antibodies against hGH and subsequently treated with α-mIgG HRP and α-hIgG 647 for visualisation. In the hIgG-hGH conjugate Western blot (nonreducing conditions), two separate bands with different molecular weights are visible after immunodetection. These can be contributed to the formation of mono- and bi-conjugated hGH to hIgG.

In organic chemistry, a bipolaron is a molecule or part of a macromolecular chain containing two positive charges in a conjugated system. The charges can be located in the centre of the chain or at its termini. Bipolarons and polarons are encountered in doped conducting polymers such as polythiophene. It is possible to synthesize and isolate bipolaron model compounds for X-ray diffraction studies. The diamagnetic bis(triaryl)amine dication 2 in scheme 1 is prepared from the neutral precursor 1 in dichloromethane by reaction with 4 equivalents of antimony pentachloride.

While motility measurements are critical for identifying the presence of hyperactive motility, additional methods have been developed to identify the occurrence of the acrosome reaction. A simple method uses Coomassie brilliant blue G250 to stain cells, providing visual evidence of intact or reacted acrosomes. More advanced techniques employ fluorescent or electron microscopy methods. Fluorescein-conjugated Peanut agglutinin (FITC-PNA) or Pisum sativum agglutinin (FITC-PSA) can be used to fluorescently tag the acrosome of sperm cells, which can be then used to assess the status of the acrosome using a fluorescent microscope.

As part of phase II metabolism, the resulting carboxylates are then often conjugated by other enzymes to increase solubility and eventually excreted. This enzyme is known to hydrolyze aromatic and aliphatic esters and can manage cellular cholesterol esterification levels. It may also play a role in detoxification in the lung and/or protection of the central nervous system from ester or amide compounds. The protein contains an amino acid sequence at its N-terminus that sends it into the endoplasmic reticulum where a C-terminal sequence can bind to a KDEL receptor.

Old Malayalam is the period of the Malayalam language spanning the 1st century BC to the 4th century AD (100 BCE - 325 CE). Malayalam seems to have been influenced by Sanskrit as there are numerous Sanskrit words in the language. There are personal terminations for verbs that were conjugated according to gender and number. From the copper-plate deeds of this period and from the records of daily events that used to be kept in certain ruling families of this at this period, the progress of the language that had been made can be concluded.

Asturian dictionary, published by the Academy of the Asturian Language Asturian grammar is similar to that of other Romance languages. Nouns have three genders (masculine, feminine and neuter), two numbers (singular and plural) and no cases. Adjectives may have a third, neuter gender, a phenomenon known as matter-neutrality. Verbs agree with their subjects in person (first, second, or third) and number, and are conjugated to indicate mood (indicative, subjunctive, conditional or imperative), tense (often present or past; different moods allow different tenses), and aspect (perfective or imperfective).

The ileum is very efficient at absorbing the glyco- and taurine-conjugated forms of the bile salts. The apical sodium-dependent bile salt transporter (ASBT, IBAT, gene symbol SLC10A2) is the first step in absorption at the brush-border membrane. The cytoplasmic ileal bile acid binding protein (IBABP, ILBP, gene symbol FABP6) and the basolateral heterodimer of OSTα and OSTβ transfer bile acids through and out of the cell where they eventually enter the portal vein. These bile acid transporters are all highly expressed in the ileum but not in the liver, jejunum or colon.

In a perfect system, there would exist wavelengths that can be used to provide 1:0 and 0:1 ratios of the isomers, but in real systems this is not possible, since the active absorbance bands always overlap to some extent. In order to incorporate photochromics in working systems, they suffer the same issues as other dyes. They are often charged in one or more state, leading to very high polarity and possible large changes in polarity. They also often contain large conjugated systems that limit their solubility.

More specifically, poly(dibutylstannane) for example showed an endothermic phase transition at ~0 °C from a rectangular to a pure nematic phase, as determined by X-ray diffraction.F. Choffat, S. Käser, P. Wolfer, D. Schmid, R. Mezzenga, P. Smith, W. Caseri, Macromolecules, 2007, 40, 7878. As expected, polystannanes were semi-conductive. Temperature-dependent, time-resolved pulse radiolysis microwave conductivity measurements of poly(dibutylstannane) yielded values of charge-carrier mobilities of 0.1 to 0.03 cm2 V−1 s−1, which are similar to those found for pi-bond-conjugated carbon-based polymers.

Belantamab mafodotin, sold under the brand name Blenrep, is a medication for the treatment of relapsed and refractory multiple myeloma. The most common adverse reactions include keratopathy (corneal epithelium change on eye exam), decreased visual acuity, nausea, blurred vision, pyrexia, infusion-related reactions, and fatigue. Belantamab mafodotin is a humanized IgG1κ monoclonal antibody against the B-cell maturation antigen (BCMA) conjugated with a cytotoxic agent, maleimidocaproyl monomethyl auristatin F (mcMMAF). The antibody-drug conjugate binds to BCMA on myeloma cell surfaces causing cell cycle arrest and inducing antibody-dependent cellular cytotoxicity.

The pneumococcal polysaccharide vaccine most commonly used today consists of purified polysaccharides from 23 serotypes (1, 2, 3, 4, 5, 6b, 7F, 8, 9N, 9V, 10A, 11A, 12F, 14, 15B, 17F, 18C, 19A, 19F, 20, 22F, 23F, and 33F). Immunity is induced primarily through stimulation of B-cells which release IgM without the assistance of T cells. This immune response is less robust than the response provoked by conjugated vaccines, which has several consequences. The vaccine is ineffective in children less than 2 years old, presumably due to their less mature immune systems.

To perform a test, the sample in question is mixed with a buffer specific to the RSID test. The sample is then deposited onto the sample window where it is pulled through the test and control regions by a paper wick via passive diffusion. The RSID unit is impregnated with fluid-specific antibodies conjugated to colored complexes that will re-dissolve and diffuse at this time. If the fluid in question is present in the questioned sample, antibodies at the test line will react to the colored antibody complexes and form a colored line.

The O-alkyl cleavage of the ester bond, assisted by an Fe(II) cofactor, creates a carbocation intermediate that is stabilized by the conjugated polyene chain. The delocalization of the carbocation reduces the bond order of the polyene chain, thereby reducing the activation energy of the trans-to-cis isomerization. Phe103 and Thr178 additionally stabilize the isomerized carbocation and are thought to be responsible for the stereoselectivity of the enzyme. After isomerization, a nucleophilic attack by water at C15 restores the conjugation of the polyene chain and completes the ester bond cleavage.

Maintaining an electric field in an electrolyte requires Faradaic reactions to occur at the anode and cathode. This is typically electrolysis of water, which generates hydrogen peroxide, hydrogen ions (acid) and hydroxide (base) as well as oxygen and hydrogen gas bubbles. The hydrogen peroxide and/or pH changes generated can adversely affect biological cells and biomolecules such as proteins, while gas bubbles tend to "clog" microfluidic systems. These problems can be alleviated by using alternative electrode materials such as conjugated polymers which can undergo the Faradaic reactions themselves, dramatically reducing electrolysis.

Attachment of UBLs might, alter substrate conformation, affect the affinity for ligands or other interacting molecules, alter substrate localization, and influence protein stability. UBLs are structurally similar to ubiquitin and are processed, activated, conjugated, and released from conjugates by enzymatic steps that are similar to the corresponding mechanisms for ubiquitin. UBLs are also translated with C-terminal extensions that are processed to expose the invariant C-terminal LRGG. These modifiers have their own specific E1 (activating), E2 (conjugating) and E3 (ligating) enzymes that conjugate the UBLs to intracellular targets.

Italian forms a progressive aspect in much the same way as in Spanish, using a conjugated form of the verb stare ("to stay") followed by the gerund of the main verb. There are only two forms of gerunds, the choice depending upon the ending of the main verb in the infinitive: -ando for verbs whose infinitive ends in -are (parlare/parlando, mangiare/mangiando) or -endo if the infinitive ends in -ere or -ire (leggere/leggendo, dormire/dormendo). Thus 'I am speaking/reading/sleeping' is expressed Sto parlando/leggendo/dormendo.

Tuataric acid is an organic compound and an unsaturated carboxylic acid. This colourless compound was isolated in 2009 from the cloacal glands of the tuatara, a lizard-like reptile native to New Zealand. Its formal name is (4E,6Z)-octa-4,6-dienoic acid, and it consists of an unusual pair of conjugated alkene units with the E and Z configurations. Tuataric acid can be prepared from pent-4-yn-1-ol through a sequence that begins with the extension of the alkyne terminus by hydroboration and ends with the oxidation of the alcohol.

The phase transition associated with ELPs can also be used to promote tumor cell uptake of the drug. By locally heating tumor cell regions, the ELP-drug complex will aggregate into spherical clumps. If this ELP-drug complex is engineered to expose functional domains in the spherical clump shape that are recognized by tumor cell surfaces, then this cell surface interaction would promote uptake of the drug as the tumor cell would mistake the ELP-drug complex as being a harmless substance. Depicted above is the chemotherapeutic agent Doxorubicin conjugated with ELPs.

The biggest dispute between them was on the Gresley conjugated valve gear for 3-cylinder engines. This valve gear arrangement worked well during peacetime but experienced problems due to poor maintenance during the Second World War, giving Thompson some justification for his criticism of the design. Gresley's passing was very unexpected, and the LNER had no immediate successor in mind. The LNER board of directors first requested permission from the Southern Railway to approach their CME, O.V.S. Bulleid, who had been Gresley's assistant until joining the Southern four years previously.

Unlike other districts of the region (comarca) Huerta de Murcia and belonging to the municipality of Murcia, the Arab toponym of the territory did not persist. This toponym has a previous historically Spanish variant origin (related to the Spanish language spoken in previous eras). 'Nonduermas' is composed by two words: the grammar negator word of a previous historically Spanish variant 'non' and the word 'duermas', which is the verb 'dormir' conjugated, and it means 'to sleep'. Therefore, this expression is negative imperative and it can be translated as 'Don't sleep' or 'Do not sleep'.

Calaspargase pegol, sold under the brand name Asparlas, is a medication for the treatment of acute lymphoblastic leukemia (ALL). It is approved in the United States as a component of a multi-agent chemotherapeutic regimen for ALL in pediatric and young adult patients aged one month to 21 years. Calaspargase pegol is an engineered protein consisting of the E. coli-derived enzyme L-asparaginase II conjugated with succinimidyl carbonate monomethoxypolyethylene glycol (pegol). The L-asparaginase portion hydrolyzes L-asparagine to L-aspartic acid depriving the tumor cell of the L-asparagine it needs for survival.

Each section features sentence starters, pre-conjugated verbs, and sentence objects that together form phrases and questions based on the respective section."SMIGIN ES LA APP TRADUCTORA CON LA QUE NO SONARÁS COMO TURISTA". IOFacturo.mx. Retrieved on 9 March 2016 Users have the ability to hear their phrases spoken by native speakers, read simplified phonetic spelling to learn how best to pronounce them using their native syllables, and save phrases for later use. Additionally, users have the ability to create their own personal phrasebook that suits the needs of their travel experiences.

Labile molecules are present at low concentrations outside of cells (in the picomolar range) and have half-lives of only minutes when free in the ocean. They are consumed by microbes within hours or days of production and reside in the surface oceans, where they contribute a majority of the labile carbon flux. Semilabile molecules, much more difficult to consume, are able to reach depths of hundreds of meters below the surface before being metabolized. Refractory DOM largely comprises highly conjugated molecules like Polycyclic aromatic hydrocarbons or lignin.